Background
Organ transplantation is the only curative treatment for patients affected by end-stage liver or kidney disease. Although immunosuppressive (IS) drugs have reduced the incidence of acute rejection and transplantation-associated mortality, their administration is associated with major side effects, such as opportunistic infections, damage of transplanted organs and secondary cancer [
1,
2]. Therefore, new strategies to improve long-term graft survival while reducing/eliminating IS therapy and, ideally, inducing immunological tolerance are needed.
Cellular therapy can improve the outcome of solid organ transplantation through anti-inflammatory effects and the induction of immune tolerance. T cell-mediated immunomodulation is one of the main mechanisms to maintain operational tolerance (withdrawal of immunosuppressive drugs while maintaining normal graft function and histology) in vivo. It is now accepted that regulatory T cells (Tregs), a subpopulation of T helper lymphocytes, are responsible for this immunomodulatory activity, as a result of their suppressive effects directly on effector T cells and on antigen presenting cells [
3,
4]. Circulating Tregs constitutively express CD25 and FoxP3 and represent 5–10% of all peripheral CD4+ T cells [
5,
6]. Tregs, which are fundamental for the maintenance of immune homeostasis, demonstrated a key role for transplantation tolerance in animal models by impairing the function of CD8+ T cells [
7‐
10]. In humans, cell therapy with human Tregs for the induction of transplantation tolerance represents a promising strategy [
10,
11]. Indeed, clinical trials using this approach have already demonstrated that expanded polyclonal and antigen-specific Tregs are safe and effective in the treatment of GVHD and Type 1 diabetes [
12‐
17]. Conversely, very few results have been published on clinical trials testing the efficacy of Tregs in solid organ transplantation [
18,
19]. Moreover, isolated/ex vivo expanded Tregs have been only tested in animal models [
20‐
22].
Here, we first established a preclinical protocol for expansion/isolation of Tregs from patients with end-stage liver or kidney disease being in the waiting list for liver/kidney transplantation (LT/KT). We then scaled up and optimized such protocol according to good manufacturing practice (GMP) to obtain high numbers of purified Tregs which were tested in vitro and in a xenogeneic acute graft-versus-host disease (GVHD) mouse model.
Materials and methods
Patients
Peripheral blood (20–60 mL) was obtained from 14 LT and 9 KT patients. Patients characteristics are outlined in Table
1. Patient selection for GMP Tregs isolation/expansion was based on the following inclusion criteria: (1) age ≥ 18 years; (2) diagnosis of end-stage kidney disease in waiting list for living donor kidney transplantation or diagnosis of end-stage liver disease in waiting list for liver transplantation. Exclusion criteria included: (1) HIV, HBV, HCV positivity; (2) syphilis antibody positivity; (3) combined transplant; (4) concurrent uncontrolled infection. Patient selection for in vitro experiments were as above described except virus positivity. Peripheral blood (20–60 mL) and buffy-coat (30 mL) were also obtained from age and sex matched healthy controls. Human studies were conducted in accordance with the Declaration of Helsinki and approved by the local ethical Committee (
232/2015/O/Tess by Investigation Drug Service,
Azienda Ospedaliero-
Universitaria di Bologna). Informed consent was obtained from all the subject prior to enrollment into the study.
Table 1
Patients characteristics
Total number | 9 | 14 | 10 |
Sex (male/females) | 3/6 | 8/6 | 5/5 |
Age (years; mean ± SD) | 53 ± 13 | 61 ± 10 | 58 ± 12 |
Disease |
HCV/HBV liver cirrhosis | N = 0 | N = 8 | NA |
Alcoholic liver cirrhosis | N = 0 | N = 3 | NA |
Dysmetabolic liver cirrhosis | N = 0 | N = 2 | NA |
Cryptogenetic liver cirrhosis | N = 0 | N = 1 | NA |
Epatorenal polycystic disease | N = 4 | N = 0 | NA |
End stage kidney disease | N = 4 | N = 0 | NA |
Drug-induced tubulointerstitial nephritis | N = 1 | N = 0 | NA |
Circulating Treg enumeration
Enumeration by flow cytometry of circulating Treg (CD4+CD25+CD127−FoxP3+) was carried out in the peripheral blood (PB) of selected KT and LT patients (n = 7 and n = 10, respectively) and of healthy controls (n = 9). The conjugated monoclonal antibodies used are shown in Additional file
1: Table S1. Surface marker staining was performed for 15 min at room temperature. For intracellular staining, anti-human FoxP3 (PCH101) Staining Set PE Kit was used (eBiosciences), according to the manufacturer’s instructions. Isotype control rat IgG2 PE was used as a control. Briefly, cells were stained for surface markers CD4, CD25 and CD127, washed once in PBS and then fixed/permeabilized. After washing, cells were incubated with anti-human FoxP3 antibody for 30 min at 4 °C in the dark. A lysis buffer (Becton–Dickinson) was used in order to lysate red blood cells. The phenotype of Tregs was analyzed by flow cytometry FACSCantoII (Beckton Dickinson). Data were analyzed using the FACSDiva software (Becton–Dickinson). The percentage of positive cells was calculated by subtracting the value of the appropriate isotype controls. The absolute number of positive cells per µL was calculated as follows: percentage of positive cells × white blood cell count (WBC)/100.
Tregs isolation and expansion
EDTA-anticoagulated peripheral blood (60 mL) was collected from 4 LT patients, 2 KT patients and buffy-coat (30 mL) from 5 controls. Peripheral blood mononuclear cells (PBMC) were then isolated by Ficoll-Hystopaque density gradient centrifugation.
Isolation: freshly isolated CD8−CD25+ T cells were purified from PBMC by negative selection of CD8+ T cells followed by positive selection of CD25+ T cells using specific Miltenyi-Biotec Beads (CD8 microbeads human and CD25 microbeads II human) with MidiMACS separator and a purity (CD4+CD25+) of > 90%.
Expansion: freshly isolated cells were plated at 1 × 106/mL cells and activated with anti-CD3/CD28 coated beads (Invitrogen, Paisley, UK; Miltenyi Biotech) at a 4:1 bead:cell ratio at day 0 and then 1:1 bead:cell ratio weekly. Cells were expanded in culture media (TECSMacs GMP medium, Miltenyi Biotech) 5% human AB plasma containing rapamycin (100 nM) (Rapamune®, Wyeth, USA) for 21 days at 37 °C and 5% CO2. IL-2 (1000 IU/mL, Proleukin®, Novartis, UK) was added at day 4 post-activation and replenished every 2 days. Cells were restimulated with beads every 7 days. After 21 days of culture, beads were magnetically removed and the cells washed in TECSMacs GMP medium. After washings, fresh beads, rapamycin and IL-2 were added. Expanded cells were used for further analysis at each time of re-stimulation up until day 21 of expansion.
Phenotypic characterization
Phenotypic characterization were performed on day 0, 7, 14, 21 of cultures for ex vivo expansion and after cryopreservation/thawing by flow cytometry as above described. Surface marker staining was performed in order to asses the content of Tregs and contaminant cells [monocytes (CD14+), B (CD19+) and T cells (CD8+), NK cells (CD56+), Th17 cells (CD196+CD161+)] present at each time point of culture (Additional file
1: Table S1).
The highly conserved Treg-specific demethylation region (TSDR) within the human
FOXP3 gene is demethylated exclusively on Tregs and not in any other blood-cell types. Specific DNA methylation of the Treg
FOXP3 is referred to intron 1, as previously identified [
23]. DNA methylation of
FOXP3 gene (CNS2 region) of expanded cells (day + 21), either freshly isolated or after cryopreservation/thawing, was evaluated for a total of 6 subjects (3 patients: 1 KT and 2 LT patients; and 3 controls). Genomic DNA was extracted from purified Tregs using the
AllPrep DNA/RNA Mini Kit (QIAGEN, Hilden, Germany). 500 ng of DNA was bisulphite-converted using the EZ DNA Methylation Kit (Zymo Research Corporation, Orange, CA) according to manufacturer’s instructions, except for the thermal conditions of the conversion (21 cycles of 55 °C for 15 min and 95 °C for 30 s). Bisulphite-treated DNA was eluted in 100 μL of water. DNA methylation analysis of the genomic region chrX:49,117,049–49,117,467 within
FOXP3 gene body was performed by EpiTYPER assay (Sequenom, San Diego, CA), a quantitative method based on mass spectrometry that allows to evaluate methylation level at single CpG sites/groups of adjacent CpG sites (CpG units). Ten ng of bisulphite-treated DNA were PCR-amplified and processed following manufacture’s instructions. The bisulphite specific primers were:
FOXP3 forward, AGGAAGAGAGATTTGTTTGGGGGTAGAGGATTTA;
FOXP3 reverse, CAGTAATACGACTCACTATAGGGAGAAGGCTCAAAAAAAACCAAATCTTCAAAACT.
For each gene, CpG sites with missing values in more than the 20% of the samples were removed, as well as samples with missing values in more than the 20% of CpG sites. The R package
massArray was used to test if bisulphite conversion reaction run to completion [
24]. For all samples analysed bisulphite conversion was from 98.9 to 100%.
Mixed leukocyte reaction assay
The T cells were used as autologous responder cells for in vitro suppression assays. The suppressive activity of freshly isolated and expanded cells were tested by co-culturing CD8−CD25− T cells, labeled with 5 µM carboxyfluorescein succinimidyl ester (CFSE, Invitrogen), with serial dilutions of freshly isolated (CD8−CD25+ T cells) and ex vivo expanded autologous Tregs in the presence of CD3/CD28 GMP beads at ratio previously shown by us (in house experiments) to be effective in dose–response experiments (1:10 CD8−CD25− T cells to bead ratio) in RPMI-1640 medium containing 10% FBS, 1% penicilline/streptomycine and l-glutamine (1%) for 5 days at 37 °C and 5% CO2. Proliferation was analyzed by flow cytometry. The percentage of proliferative CD8−CD25− T cells in the absence of Tregs was taken as 100% proliferation.
GMP Treg isolation and expansion for in vivo experiments
The GMP manufacturing was performed in the Cell Factory of Fondazione IRCCS Ca’ Granda Ospedale Maggiore Policlinico, certified in compliance with European GMP regulations by the Italian Drug Agency (authorization number aM-51/2018).
Steady state leukapheresis from 2 patients (1 KT and 1 LT patient) were processed using GMP-compliant devices and reagents (Additional file
1: Figure S1A). The subjects were evaluated for venous accesses suitability. Leukapheresis was carried out by the COM.TEC
® (Fresenius Kabi AG, Bad Homburg, Germany) cell separator. The treatment of two blood volumes was set up as the procedure end-point. ACD-A was used for anticoagulation at a ratio of 1:14–1:13. For prophylaxis of citrate-related hypocalcemia, calcium gluconate was administered intravenously during the leukapheresis.
CD8−CD25+ cells were purified using the CliniMACS System (Miltenyi Biotec, Bergisch Gladbach, Germany) according to GMP procedures and following manufacturer’s instructions. Briefly, we performed a sequential two-step process based on the magnetic depletion of CD8+ T cells, followed by a positive selection of CD25+ cells after an over night storage, using monoclonal antibodies anti-CD8 (Miltenyi Biotec) and anti-CD25 (Miltenyi Biotec), as described in the CliniMACS user manual for cell preparation, magnetic labelling, and selection.
Forty millions of CD8−CD25+ cells were expanded in vitro in gas-permeable culture bags (MACS GMP Cell Expansion Bags and MACS GMP Cell Differentiation Bags, Miltenyi Biotec) for 3 weeks in complete medium, consisting of TexMACS Medium (Miltenyi Biotec) supplemented with 100 nM rapamycin (Miltenyi Biotec), 5% allogeneic human heat-inactivated AB plasma, 500–1000 UI/mL IL-2 (Proleukin, Novartis Pharmaceuticals Canada Inc, Dorval, Quebec, Canada). On day 0, 7 and 14, anti-CD3/CD28 beads (MACS GMP ExpAct Treg Beads, Miltenyi Biotec) were added at different beads:cells ratio 4:1, 1:1, 1:1 respectively.
At day 21 all the cultured cells were collected and the beads were removed using the CliniMACS device, according to manufacturer’s instructions. Cells were counted by an automated and validated method (Nucleocounter System, Chemometec, Allerød, Denmark). The Treg markers were evaluated by flow cytometry (BD FACSCanto II, BD Bioscience, San Jose, CA, USA) using the following antibodies: CD45 APC-H7 (BD Bioscience), CD4 FITC (BD Bioscience), CD25 APC (BD Bioscience), CD127 PE-Cy7 (BD Bioscience) and FoxP3 PE (eBioscience, San Diego, CA, USA).
Negative fraction (CD8−CD25− T cells) after GMP selection at day 0 and the final product after GMP expansion at day 21, were cryopreserved and thawed as above described.
Cryopreservation and thawing of freshly isolated and expanded cells
Freshly isolated fractions (CD8−CD25+ and CD8−CD25− T cells) and expanded cells (after 7, 14 and 21 days of expansion) were washed and cryopreserved with 10% DMSO (CRYOSERV, Mylan Institutionals, Canonsburg, PA, USA), 10% HSA (HAS; Kedrion, Lucca, Italy) in a saline solution (B. Braun, Melsungen, AG, Germany) using a controlled-rate freezer. The frozen units were transferred and stored immediately to vapor-phase liquid nitrogen into dedicated tanks. All the cellular fractions were thawed at 37 °C and the viability, phenotype and suppressive function were assessed as above described.
Xenogeneic GVHD mouse model
NOD scid gamma (NSG) female mice (6–7 weeks of age) were purchased from Charles River (Calco, Italy). All animals were housed under specific pathogen-free conditions in compliance with guidelines of the San Raffaele Institutional Animal Care and Use Committee (IACUC number: 632). Mice were maintained for at least 5 days in the animal facility for acclimatization before transplantation. To promote the engraftment of transplanted cells injected intraperitoneally, all mice were conditioned with total body irradiation (1.75 cGy) on day 1. Of note, day 1 of the study is considered the day of transplant. All groups of mice, transplanted as well as control mice, were monitored for 7 weeks. Clinical signs of GVHD (e.g., hunched back, fur loss, skin inflammation) were monitored daily. Body weight was monitored throughout the duration of the study. Animals showing marked clinical signs as of distress, loss of weight equal to or greater than 20% of their starting weight were immediately sacrificed.
To establish whether the expanded Tregs could counteract acute GVHD, a xeno-GvHD model was induced by intraperitoneally transfer of human autologous CD8−CD25− T cells from 1 LT and 1 KT patient into mice. Both CD8−CD25− T cells and expanded Tregs were injected within 30 min from thawing (Additional file
1: Figure S1B). Specifically, human CD8−CD25− T cells (6 × 10
6) from LT or KT patients were injected with (simultaneous injection) or without autologous Treg (6 × 10
6) at a Treg: CD8−CD25− T cells ratio of 1:1. Timing of Treg infusion is crucial. In our model Tregs were infused at the time of T effector transplantation.
In vivo engraftment monitoring
To assess the in vivo persistence of human cells, transplanted mice were bled 4 weeks after transplantation and sacrificed 7 weeks after transplantation. Phenotype analysis of injected cells and of peripheral blood at 4 weeks (± 3 days) after transplantation and of PB and spleen at 7 weeks (± 3 days) after transplantation was performed (Additional file
1: Figure S1C). Following a Fc blocking step, cell surface staining was performed with anti-mouse CD45 and anti-human CD4, CD3, CD25, FoxP3 mAbs at 1:100 dilution in staining buffer (PBS, 2% FCS, 0.1% NaN3) (list of mAbs is in Additional file
1: Table S1). To detect FoxP3, cells were treated and stained with the FoxP3 fixation/permeabilization kit according to the manufacturer’s instructions (eBioscience). Samples were acquired on a BD FACSCanto II flow cytometer. Manual analysis of flow cytometry data was performed with FCS Express V4 (DeNovo Software, Glendale, CA).
Statistical analysis
Statistical analyses were performed using GraphPad Prism (GraphPad Prism 5.0 soft-ware, SanDiego CA, USA), and data are presented as mean ± standard error of the mean (SEM). For all experiments involving multiple comparisons, analysis of variance (ANOVA) followed by a Dunnett’s post hoc test was used. For those who involved comparisons between two groups, Student’s t-test was used. The level of significance was set at p ≤ 0.05.
Discussion
The use of Tregs for the treatment of GVHD and for inducing operational tolerance after solid organ transplantation is a promising approach.
Here, we isolated, expanded and functionally characterized Tregs from patients with end stage kidney and liver disease, with the aim to establish a suitable method to obtain immunomodulatory cells for adoptive immunotherapy post-transplantation.
We demonstrated that fully functional Tregs from patients in waiting list for solid organ transplantation can be isolated/expanded for clinical studies. These cellular products show homogenous regulatory T cells characteristics with very low percentage of contaminating cells. Therefore, unwanted immune side effects are minimized. Of note, based on phenotype/function, the isolated/expanded Tregs from KT and LT patients are similar. Interestingly, our cryopreservation/thawing procedure allowed cell suspensions with phenotype/function and hypomethylation of the
FOXP3 gene superimposable to that of the freshly isolated counterparts. This finding challenges the notion that cryopreservation of Tregs products is detrimental for their function [
25,
26].
Our freshly isolated cells from healthy donors and LT/KT patients showed limited suppressive activity. This is in contrast with previous findings demonstrating 60–80% of suppressive activity by freshly isolated healthy donors cells, which were CD8−CD19−CD25+ cells [
22] or CD8−CD25+ cells [
27]. However, our results may be due (1) to the low purity of our freshly isolated cell suspension (CD8−CD25+ cells) and (2) to the fact that while our suppressive activity results were based on a 1:2 Treg/CD8−CD25− T cells working ratio, their ratio was 1:1 Treg/Teff. Whether this results is also due to the fact that our freshly isolated healthy donors cells derive from 24 h aged buffy-coats remains a matter of speculation.
Safinia et al. [
10] firstly proposed a GMP production protocol to expand CD25+-enriched cells from PB in the presence of IL-2 and rapamycin to induce tolerance after liver transplantation. In their 36 days expansion protocol, multiple round of in vitro Treg stimulation were necessary to achieve clinically relevant Tregs number. In our protocol indeed, we obtained fully functional Tregs after 21 days of expansion containing less than 1% of contaminating CD8+ effector cells. Expanded, cryopreserved and thawed Tregs remain hypomethylated at intron 1 of the
FOXP3 locus, confirming their epigenetic stability. Functionally, Tregs showed suppressive function against autologous CD8−CD25− T cells.
Several human Treg products have been tested in animal models. However, previous data of Treg cell infusion in non human primates report conflicts regarding the ability of the infused cells to induce transplant tolerance [
28‐
30]. Thus, we decided to use a mouse model of GVHD in immunodepressed mice [i.e. NOD-SCID-gamma KO (NSG) mice] receiving human effector T cells with or without GMP Tregs to prevent the onset of xenogeneic GVHD. In our mouse model, GMP Tregs from LT or KT patients proved to be safe and showed a trend toward reduced lethality of acute GVHD in vivo. Interestingly, GMP Tregs from LT and KT patients did not induce xenogenic GVHD and did not expand as documented by the absence of Tregs in the PB and spleen of mice after 4 and 7 weeks from transplantation. This is probably due to the lack of human IL-2.
Nevertheless, our data are consistent with previous models of xenogeneic GVHD and Treg infusion. The addition of CD25 expressing cells to human PBMC showed the amelioration of xenogeneic GVHD, whereas the depletion of all CD25+ cells led to the development of lethal xenogeneic GVHD [
31]. Also, in vitro expanded Tregs from human peripheral blood or cord blood were able to ameliorate or suppress xenogeneic GVHD [
32,
33]. More recently, it has been reported that the infusion of polyclonal human Tregs improved murine xenogeneic chronic GVHD [
34]. In addition, Del Papa et al. [
22] used a similar methodology (immune-magnetic Treg isolation and polyclonal expansion in the presence of CD3/CD28 beads, IL-2, and rapamycin for 19 days) achieving a median of 8.5-fold expansion and maintaining FoxP3 expression over the culture period. NSG mice that received human leukemic cells and expanded Tregs with conventional T cells were rescued from leukemia and survived without GVHD. Mice that received leukemic cells plus conventional T cells died of severe GVHD within 70 days.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.