Background
Colorectal cancer (CRC) is the third leading cancer worldwide and the fourth most prevalent neoplasm, with most rapidly increasing incidence and mortality [
1]. At present, the five-year survival for CRC is only 64.9% [
2]. Once CRC goes into advanced stage, surgical resection is useless and the prognosis of patients is extremely disappointing [
3,
4]. Tumor progression is deeply influenced by the local microenvironment. The activated fibroblasts are often called cancer-associated fibroblasts (CAFs), which are currently identified as one of the most active cell types of the tumor microenvironment (TME) [
5]. CAFs, as important components of the TME, can interact with cancer cells to facilitate tumorigenesis and progression [
6]. Herein, with the unraveling of the relationship between CAFs and tumors, CAFs are considered as an important target for anti-cancer therapy.
Long noncoding RNAs (lncRNAs) represents a novel type of noncoding RNAs that greater than 200 nucleotides with limited protein-coding ability [
7]. LINC00659, a long noncoding RNA, has been characterized as a novel oncogene that its expression level is considerably increased in CRC [
8]. Although previous finding has supported the vital roles of LINC00659 in tumorigenicity, little is known about the upstream factors that induce the abundant expression of LINC00659 in CRC.
RNA molecules, such as lncRNAs, circular RNAs, miRNAs and mRNAs are excessively enriched in exosomes, which are secreted by multiple cell types [
9,
10]. Accumulating evidences have revealed that exosomes are implicated in the dynamic crosstalk between CAFs and cancer cells that can shape the tumor environment, thus promoting tumor progression [
11,
12]. Exosomes can serve as critical mediators between stroma intercellular and cancer cell communication via transferring genetic message associated contents in TME [
6,
13]. Additionally, the ncRNA-loaded exosomes could mediate the TME of cancer cells by acting as mediators [
14‐
16]. However, the mechanisms by which exosomes regulate LINC00659 expression and its functional role in CRC cells remain dismal. Fluorescence in Situ Hybridization (FISH) in this study found LINC00659 mainly located in the cytoplasm of CRC cells. Further experiments identified that lncRNA LINC00659 can be transferred from CAFs to CRC cells by exosomes. Therefore, we hypothesized that LINC00659 in CAFs-exo may exerts its function in CRC cells through ceRNA mechanism. This study was performed with the aim to explore the possible role and mechanism ofLINC00659 in CRC progression.
Materials and methods
Cell culture
The human CRC cell lines LOVO and SW48, obtained from American Type Culture Collection (ATCC, USA), were fostered in DMEM/F12 medium (Thermo Fisher Scientific, Wilmington, DE, USA) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Wilmington, DE, USA) in a 5% CO2 atmosphere at 37 °C.
Isolation and culture of CAFs
Human CAFs (CRC group) and normal fibroblasts (NFs) (normal group) were acquired from fresh CRC and adjacent normal tissues. Tissue samples were collected from patients after written consents and approval of the Ethics Committee of Xiangya Hospital, Central South University were obtained. Part of the cells was used for detection of LINC00659 in CRC tissues using qRT-PCR and FISH. Tumor tissues and paired normal tissues were washed with sterile PBS. Then, the tissues were chopped into small pieces and digested with 0.1% of collagenase I (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) at 37 °C. The digested mixtures were centrifuged and rinsed in DMEM medium (Gibco, Grand Island, NY, USA) to remove the fat and tissue debris. Thereafter, tissues were fostered in DMEM medium (Gibco, Grand Island, NY, USA) containing 15% FBS for about 2 days. After the suspending cells and tissues were removed, the most adherent cells were fibroblasts, macrophages and epithelial cells. After 3 ~ 5 days of incubation, macrophages and epithelial cells were apoptotic with only fibroblasts saved. Fresh medium was replaced whenever deemed necessary. The primary fibroblasts isolated from tumor tissues were named “CAFs”, and from tumor paired normal tissues named “NFs”. Cells were used for study after 3 generations of culture and measured using microscopical measurement.
Co-culture of fibroblasts and CRC cells
Transwell plates (Corning, NY, USA) were used to co-culture NFs and CAFs with CRC cells LoVo and SW48 [
17]. NFs or CAFs were inoculated into the upper chamber while LoVo and SW48 were inoculated into the lower chamber at a density of 2 × 10
4 cells/well. Exosomes secreted by fibroblasts could allow the migration of cells through the membrane into the lower chamber. After 24 h of co-culture, the collected CRC cells from the lower chamber were used for the following experiments. The experimental groups was divided into: Control group (no treatment), NFs group (Co-culture of NFs with LoVo/SW48) and CAFs group (Co-culture of CAFs with LoVo/SW48).
Immunofluorescence
CAFs and NFs were seeded at 5000/well onto 24-well culture plates. Next, cells were fixed with 4% paraformaldehyde for 15 min, followed by 0.5% Triton-X-100 for 20 min. Thereafter, the cells were incubated with appropriate concentrations of primary antibody of α-SMA (19245S, 1:200, Cell Signaling Technology, Danvers, MA, USA), FAP (ab28244, 1:200, abcam, Cambridge, MA, USA), or Vimentin (5741S, 1:100, Cell Signaling Technology, Danvers, MA, USA) at 4 °C overnight, and then with Alexa Fluor 488-labeled second antibody goat anti-rabbit IgG (ab150077, 1:2000, abcam, Cambridge, MA, USA) away from light (45 min, room temperature). Next, the secondary antibody solution was removed and the cells were washed thrice by PBS (5 min) and then cultured with 0.5 µg/ml DAPI (5 min) at room temperature in the dark, followed by PBS wash (2 × 5 min). Finally, the immunofluorescence was visualized under a fluorescence microscope (BX61FL, OLYMPUS, Tokyo, Japan).
Extraction and identification of exosomes
CAFs-derived exosomes (CAFs-exo) and NFs-derived exosomes (NFs-exo) were extracted by ultra-centrifugation: the supernatants from cell culture medium were collected and centrifuged at 4 °C at 2000 g for 30 min, 10,000 g for 40 min and 100,000 g for 70 min to separate deposited debris and supernatants. After washing twice with PBS, the deposited debris were centrifuged (100,000 g, 70 min, 4 °C) and subsequently resuspended in PBS and storage at − 80 °C.
Electron microscope observation: exosome suspensions were collected and then dripped onto a copper grid (1 min, room temperature). Thereafter, the exosomes were negatively stained with 3% (w/v) sodium phosphotungstate solution for 5 min, and washed under H2O and dried naturally at room temperature. Lastly, exosomes were observed and photographed using a transmission electron microscope (CM‐120, Philips, Eindhoven, Netherlands).
Exosome identification: the expressions of exosomal marker CD9, CD81 and TSG101 were monitored by flow cytometry (FCM) and Western blot.
FCM: 100 μl of exosome suspensions were incubated with appropriate primary antibody of CD9 (ab2215, 1:200, Abcam), CD81 (ab79559, 1:1000, Abcam), or TSG101 (ab83, 1:500, Abcam) for 30 min. Cells were further incubated for 30 min with FITC-conjugated secondary antibody goat anti-mouse IgG (ab6785, 1:1000, abcam). Exosomes were treated with RNase or RNase + TritonX-100 to detect LINC00659 expression.
In brief, l μl of DiI (Santa Cruz Biotechnology, USA) was added to 100 μl exosome suspensions and the mixture was then incubated at 37℃ for 1 h in the dark. Exosomes were collected by ultra-centrifugation, and then resuspended in PBS before wrapped in foil and stored at -80℃. LoVo and SW48 cells were seeded into a 6-well plate (105/well) and incubated at 37℃ in a 5% CO2 incubator overnight. The DiI-labeled exosomes were added into the 6-well plate after the cells were adhered to the wall. With further incubation for 24 h, LoVo and SW48 cells were stained with DAPI, and the exosomes were visualized and photographed via a fluorescence microscope (BX51, Olympus, Tokyo, Japan).
Exosome inhibition experiments
To further verify the role of exosomes, exosome secretion was inhibited using Sphingomyelinase inhibitor GW4869 and 10 µM of GW4869 (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) was used to treat CAFs (designated GW4869-CAFs group), while Control group was treated with DMSO (designated DMSO-CAFs group). After 12 h, cells were washed thrice with sterile PBS before 10 ml of serum-free DMEM (Gibco, Grand Island, NY, USA) was added. CAFs were collected after 2 h.
Cell transfection
pcDNA3.1-LINC00659, pcDNA3.1-ANXA2, pcDNA3.1, sh-LINC00659, miR-342-3p mimic, miR-342-3p inhibitor and their negative controls were obtained from Shanghai GenePharma Co. Ltd (Shanghai, China). All transfection was carried out using lipfectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. The exosomes (from CAFs transfected with pcDNA3.1-LINC00659 or pcDNA3.1) incubated with CRC cells were named as pc-LINC00659-exo group or pc-exo group. The exosomes (from CAFs transfected with sh-LINC00659 or sh-NC) incubated with CRC cells were named as sh-LINC00659-exo group or sh-NC-exo group. sh-NC-exo was co-incubated with CRC and then transfected with miR-342-3p inhibitor or sh-ANXA2 plasmid were named as sh-NC-exo + in-miR-342-3p group or sh-NC-exo + sh-ANXA2 group. sh-LINC00659-exo was co-incubated with CRC and then transfected with miR-342-3p inhibitor or pcDNA3.1-ANXA2 plasmid were named as sh-LINC00659-exo + in-miR-342-3p group or sh-LINC00659-exo + pc-ANXA2 group.
qRT-PCR
Total RNAs were extracted utilizing TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription was carried out through a reverse transcription kit (TaKaRa, Tokyo, Japan) based on the manufacturer’s guidance. Gene expression was detected with the LightCycler 480 (Roche, Indianapolis, IN, USA) fluorescence quantitative PCR instrument. The reaction was performed under the guidance of the fluorescent quantitative RT-PCR kit (SYBR Green Mix, Roche Diagnostics, Indianapolis, IN). The thermocycling program were as follows: 10 s denaturation at 95˚C, followed by 45 cycles of 5 s denaturation at 95˚C, 10 s annealing at 60˚C and 10 s extension at 72˚C, and a final extension step of 5 min at 72 °C. The qPCR was repeated thrice. GAPDH and U6 were used as the internal reference of mRNA and miRNA expressions, respectively. Data were calculated by 2
−ΔΔCt method, with the following formula: ΔΔCt = [Ct
(target gene)—Ct
(reference gene)]
experimental group—[Ct
(target gene)—Ct
(reference gene)]
control group. The primer sequences for all candidate reference genes are depicted in Table
1.
Table 1
Primer sequence for quantitative reverse transcription polymerase chain reaction to determine the expression levels of E-cadherin, N-cadherin, Vimentin, and Snail-1, U6, LINC00659, ANXA2, GAPDH
E-cadherin-F | CGTCGAGCTCTTGACCGAAA |
E-cadherin-R | TCAAACACCTCCTGTCCTCT |
N-cadherin-F | AGGGGAGAGGTGCTCTACTG |
N-cadherin-R | GGGGTAATCCACACCACCTG |
Vimentin-F | TCCGCACATTCGAGCAAAGA |
Vimentin-R | TGAGGGCTCCTAGCGGTTTA |
Snail-1-F | CGAGCCATAGAACTAAAGCC |
Snail-1-R | TGAGGGAGGTAGGGAAGTG |
U6-F | CTCTCGCTTCGGCAGCACA |
U6-R | ACGCTTCACGAATTTGCGT |
LINC00659-F | ACCCCTGAAGGACCATATCCA |
LINC00659-R | GGCTCGGCTGTGTCTCAAG |
ANXA2-F | CTCTACACCCCCAAGTGCAT |
ANXA2-R | TCAGTGCTGATGCAAGTTCC |
GAPDH-F | GCAAGGATGCTGGCGTAATG |
GAPDH-R | TACGCGTAGGGGTTTGACAC |
Western blot analysis
Cells were lysed by RIPA buffer (Beyotime Institute of Biotechnology, China) and protein samples were acquired. After protein concentration were determined by BCA kit (Beyotime Institute of Biotechnology, China), the corresponding volume of protein was mixed into the loading buffer, followed by heated in boiling water bath for 3 min to minimize denaturation. The electrophoresis was initially run at 80 V for 30 min, then 120 V for 1– 2 h. After being transferred on an ice bath at 300 mA for 60 min, the membrane was rinsed for 1– 2 min, and then sealed in blocking buffer for 60 min at room temperature or cultured overnight at 4˚C. Primary antibody of FAP (ab28244, 1:1000), CD9 (ab2215, 1:500), CD81 (ab79559, 1:1000), TSG101 (ab83, 1:1000), ANXA2 (ab41803, 1:1000) (all from abcam, Cambridge, MA, USA), α-SMA (19245S, 1:1000), E-cadherin (3195S, 1:1000), N-cadherin (13116S, 1:1000), or Vimentin (5741S, 1:1000) (Cell Signaling, Boston, USA) was incubated for 1 h at room temperature. The membrane was washed with PBS thrice (10 min each), and then incubated with secondary antibodies of HRP-marked goat anti-rabbit IgG (1:5000, Beijing ComWin Biotech Co., Ltd., Beijing, China) for 1 h at room temperature and washed repeatedly (3 × 10 min). Finally, the signals were detected by chemiluminescence imaging system (Bio-rad).
Cell counting kit-8 (CCK-8) assay
The transfected cells were seeded at density of 2 × 103 cells/well in 96-well plates. Triplicates were conducted and cells were fostered in a 5% CO2 incubator at 37˚C. Cell viability was measured utilizing Cell Counting Kit (CCK-8, Tokyo, Dojindo, Japan). Afterwards, 10 μL of CCK-8 solution was added into each well, followed by incubated for 2 h at 37 °C in 5% CO2. The culture medium was then removed and the plates were washed twice by PBS. Finally, the plates were detected at 450 nm wavelength to obtain absorbance value (OD value). The average OD value for each sample tested was performed thrice.
After transfection for 24 h, the collected cells of each group were trypsinized and centrifuged for 5 min at 1500 rpm at 25 °C and then resuspended in complete medium. Thereafter, cells were seeded into 6-well plates (500 cells/well) containing 2 ml of complete medium and were maintained at 37 °C in an atmosphere of 5% CO2 for 2 to 3 weeks. When clones were visible to the naked eye, the culture was terminated and the culture medium was removed. Cells were rinsed in PBS for two times and then fixed with 1.5 ml of formaldehyde for 15 min. Afterwards, cells were stained with 1 ml of Giemsa solution in the dark for 20 min. After that, Giemsa solution was slowly washed away with running water. The plates were air-dried in an inverted position and the number of cells was counted.
Cell scratch test
Cell scratch test was conducted as described previously [
18]. In brief, the cells in the control and the experiment groups were plated in six-well plates. When cells were achieved 90% confluence, three scratches were drawn in the plate with a 100 μL pipette tip. Afterwards, cells were washed with PBS, followed by replaced with serum-free medium and incubated for 24 h. The gap between cells was photographed under a low-magnification phase-contrast microscope (Olympus MK, Tokyo, Japan).
Transwell assay
Matrigel test: A chamber coated with Matrigel stored at -20℃ was removed and melted at room temperature. Next, serum-free medium (0.5 ml) was added into Transwell chamber (coring, New York, USA) and then plated in 24-well plate for 2 h in 5% CO2 at 37 °C until the nutrient was fully absorbed. Thereafter, Cells (1 × 105) were inoculated into Transwell chamber in which the culture medium containing 1% FBS was added to 500 µL, and 0.75 ml of culture medium containing 15% FBS was then added into the lower chamber, followed by incubated at constant temperature and humidity (37℃, 5% CO2) for 20 h. Then, the culture medium on the upper chamber was discarded. After being washed two times with PBS (calcium-free), the cells were then fixed 10 min with 4% paraformaldehyde. After being washed with PBS twice (2 min each), the cells were stained with crystal violet for 10 min. Cells and the upper Matrigel layer were removed and rinsed with PBS thrice. Cells were visualized and counted from six randomly selected fields under a microscope (200 × magnification).
Expression data from the cancer genome atlas
The Transcriptome expression profile of CRC was downloaded from TCGA database (
http://gepia.cancer-pku.cn/index.html). A total of 275 cases of CRC tissues and 348 cases of adjacent normal tissues were obtained. The criteria for selection were set at |Log2FC|> 1,
p value < 0.01, among which the data for 370 cases of CRC patients were included for survival analysis.
Dual-luciferase reporter gene assay
The binding sites of LINC00659 and miR-342-3p, miR-342-3p and ANXA2 were performed by the online software Starbase 2.0 (
http://starbase.sysu.edu.cn/index.php). The mutated and wild-type biding sites for LINC00659 and ANXA2 were designed based on the prediction results. Then, the binding sequences were cloned into luciferase reporter gene vector (pGL3-Basic), and the recombined vector was co-transfected with 30 nM of miR-342-3p mimic, miR-342-3p inhibitor, or their negative controls into HEK-293 T cells, respectively. After that, the activities of firefly luciferase and Renilla luciferase in each well were assessed. Activity of renilla luciferase was used as an internal reference, and the relative activity of luciferase was the ratio of firefly luciferase to Renilla luciferase activities.
Statistical analysis
GraphPad Prism 6.0 (GraphPad Software Inc.) and SPSS 18.0 (IBM Corp., Armonk, NY, USA) were used for data analysis. Continuous data were expressed as mean ± standard deviation. Two groups were compared utilizing t test, and one-way analysis of variance (ANOVA) was applied to determine the comparison among multiple groups. P < 0.05 was deemed as statistically significant.
Discussion
Firstly we identified LINC00659 was highly expressed in CAF-exo than that in NF-exo. Meanwhile, evidence in a previous study and TCGA database showed increased expression of LINC00659 in CRC tissues. Therefore those observations intrigued us to further explore the mechanism of LINC00659 in CRC. In the present work, we uncovered that, for the first time, exosomes from CAFs can transfer LINC00659 to CRC cells and are correspondingly associated with CRC cell development. Further, CRC tumor expresses obviously higher levels of lncRNA LINC00659 than do normal cells, and the mechanism herein illustrates that exosomal LINC00659 functioning as a ceRNA mediates miR-342-3p/ANXA2 axis, thereby promoting cell proliferation, invasion, migration and EMT in CRC.
In our study, GW4869 was used to inhibit the secretion of exosomes in CAFs. GW4869 is a neutral Sphingomyelinase inhibitor and is believed to the inhibitor for exosomes. The result by transmission electron microscope showed that GW4869 group had suppressed exosomes in CAFs. Meanwhile, our study also showed that NFs and GW4869 groups showed no significant difference on cell proliferation. Recently, mounting evidence has shown that CAFs enhance the development in several tumor types [
21‐
23], through either re-modifying the TME or regulating the gene expression of the tumor cell itself. Here, we manifested that CAFs secreted exosomes potentiated CRC cell proliferation, invasion, migration and even EMT progression, indicating that CAFs are one of the motivators for CRC cell progression. Our finding of CAFs being responsible for CRC progression agrees with several previous reports [
24,
25]. Therefore, CAFs might be a promising therapeutic target for CRC prognosis.
Dysregulation of lncRNAs in cancer cells that involved in cancer growth and progression has been widely reported [
26‐
28]. Besides, lncRNAs in CAFs are increasingly recognized to be important elements for tumor development in multiple solid tumors [
29,
30]; however, the role of LINC00659 in CAFs is unclear. The present study showed that LINC00659 is overexpressed in CAFs and CAFs-exo of CRC compared with NFs. Importantly, CAFs transferred exosomes to CRC cells, resulting in an increase of LINC00659 in CRC cells. Further study presented that LINC00659 can be transferred to CRC cells to induce cell proliferation, migration and invasion, indicating that LINC00659 is the mediator participating in CAFs and CRC cell communications. Moreover, TCGA database showed that LINC00659 expression was closely correlated with the prognosis of CRC patients. This observation was in consistent with previous evidence [
8]. Previous study reported that LINC00659 aggravates the progression of CRC via multiple mechanisms [
8]. As distinguished from other studies of LINC00659 functioning in tumor cells, our study focused on the function of LINC00659 in assisting CAFs to regulate CRC, indicating that targeting LINC00659 or blocking its transport from CAFs to CRC cells could be a possible strategy for CRC treatment. However, there is one ambiguous point that we have not elucidated. Although LINC00659 has been verified to be an important role in CRC by CAFs, the target genes participating in the LINC00659-mediated regulation of cell development remain unknown.
Recently, increasing evidence has shown that lncRNAs played a distinctive role by acting as ceRNAs in tumor progression [
31,
32]. In this regards, the current report was then undertaken to explore the underlying ceRNA network underlying LINC00659. Initially, we found that CAFs-exo could suppress miR-342-3p to promote ANXA2 expression. Then, Starbase and dual luciferase reporter assays corroborated that exosomal LINC00659 and ANXA2 were verified to directly target miR-342-3p. Study has shown that miR-342-3p acts as a tumor suppressor [
33], and was downexpressed in CRC [
34]. In addition, ANXA2 is strongly expressed in pancreatic cancer and facilitates pancreatic cancer progression [
35], and literature has also reported the implication of ANXA2 in the prognosis and diagnosis of CRC [
36]. Moreover, silence of ANXA2 suppresses TGF-β induced CRC cell invasion, while inhibition of Src/ANXA2/STAT3 could reverse EMT progression [
37]. Although the implication of miR-342-3p in CRC cells was reported in a previous study [
38], the possible interaction of miR-342-3p and ANXA2 on development of CRC cells have not yet been cleared. Our findings uncovered that exosomal LINC00659 from CAFs down-regulated miR-342-3p and upregulated expression of ANXA2, which contributed to the facilitation of CRC cell development and EMT. For the above observations, we have ultimately deduced that exosomal LINC00659 can act as a ceRNA via sponging miR-342-3p to regulate ANXA2 in CRC cells.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.