Background
Microglial cells, often thought of as the resident macrophages of the central nervous system (CNS), act as the immune cells of the brain and spinal cord. Microglia become activated by disturbances in the homeostasis of their local microenvironment. Activation of microglial cells results in a cascade of phenotypic changes including, but not limited to, morphology, transcription, and cytokine production. While there are varying degrees of microglia activation [
1], two main polarized states are established: a pro-inflammatory reactive state induced by exposure to stimuli like lipopolysaccharide (LPS) and interferon-γ (IFNγ) and an anti-inflammatory state to promote repair and resolution of inflammation, which is induced by factors such as interleukin-4 (IL-4) and interleukin-13 (IL-13) [
2,
3].
The ability to polarize between reactive and repair states allows microglia to actively transition from an immune-stimulating antimicrobial phenotype to one that supports tissue repair and resolution of inflammation [
1]. Dysregulation of the activation state of microglial cells can be detrimental to CNS health. Several neurodegenerative diseases including Alzheimer’s disease and Parkinson’s disease have been attributed to chronically activated pro-inflammatory microglial cells [
4‐
10]. Chronic activation of microglial cells is thought to result from multiple stimuli ranging from systemic infection, misfolded proteins, or cellular debris within the CNS [
5]. In the case of the Alzheimer’s disease brain, microglia are activated by amyloid-β (Aβ) peptides, which are cleared from the interstitium by phagocytosis. As the disease persists, microglia become chronically activated by Aβ peptides and produce excessive amounts of pro-inflammatory cytokines leading to autocrine reduction of microglial Aβ receptors and ultimately decreased Aβ clearance from the interstitium [
11].
Regardless of the provoking stimuli, efforts to target activated microglia for the treatment of certain neurodegenerative diseases include pharmacological re-polarization to the more anti-inflammatory phenotype [
2,
12]; cannabinoids represent one class of pharmacological agents currently being examined. Unfortunately, studies of microglial cell function are limited by low yields of primary microglial cells (approx. 500,000 cells per adult mouse brain) along with potential activation during isolation. Several immortalized microglia cell lines have been generated [
13,
14] and provide experimental advantages of a homogeneous population of cells that can proliferate more rapidly. Most microglial cell studies have relied on the murine BV-2 cell line which was immortalized by infection of embryonic brain mononuclear cells with a v-raf/v-myc oncogene-carrying retrovirus [
14,
15]. However, more recent evidence suggests that microglial cells of the adult brain are derived from myeloid progenitors [
16]. Therefore, the embryonic origin of BV-2 cells raises questions about their epigenetic state and whether they truly resemble resident microglia in the adult brain.
Here, we report the generation and characterization of a novel cell line using microglia purified from the adult mouse brain. These cells were established using the Percoll gradient isolation followed by culture conditions that selectively promote microglial cell growth [
17,
18]. This study characterizes the properties of the immortalized microglia (IMG cells), which express markers specific to primary adult microglial cells (CD11b and F4/80). IMG cells respond to pro-inflammatory (LPS and Aβ) or anti-inflammatory (IL-4) stimuli. The changes induced by LPS, Aβ, and IL-4 are far greater than those induced in BV-2 cells. IMG cells provide a model system for drug candidate screening as evidenced by inhibition of Aβ-induced M1 activation by the cannabinoids delta-9-tetrahydrocannabinol (THC) and JWH-015. Lastly, we demonstrate that IMG cells retain the ability to engulf fluorescent beads and fluorescein isothiocyanate (FITC)-labeled Aβ by phagocytosis, functions that are important to explore experimentally to further our understanding of complex Aβ-microglia interactions in Alzheimer’s disease.
Methods
Cell culture and reagents
IMG, C6 glioma, and BV-2 cells were cultured in Dulbecco’s modified Eagle medium (DMEM) with high glucose (4.5 g/L), 10 % fetal bovine serum (FBS) and penicillin/streptomycin (100 U/mL). SH-SY5Y cells were maintained in DMEM/F12 (1:1 ratio) media with 10 % FBS and penicillin/streptomycin (100 U/mL). IFNγ, IL-1β, TNF-α, IL-4, IL-6, and IL-13 were purchased from Peprotech (Rocky Hill, NJ). LPS, Ac-YVAD-CMK, delta-9-tetrahydrocannabinol, and JWH-015 were purchased from Sigma Aldrich. Adenosine triphosphate (ATP) was purchased from Amersham Biosciences.
Primary microglia isolation and generation of IMG cell line
Microglia were purified from adult brain using gradient isolation methods [
19]. Proliferation and retroviral infection was carried out in medium conditioned with growth factors GM-CSF and M-CSF to selectively support microglial growth. Briefly, 8-week-old C57BL/6J mice were perfused with ice-cold phosphate-buffered saline (PBS) through the left ventricle. After collagenase digestion of brain slices, and debris removal, microglia were isolated on Percoll gradients (30 %–37 %–70 %) and collected at the 37–70 % interface. Microglial cells were maintained in DMEM (5 mM glucose), 10 % FBS, and 1 % P/S using 30 % L929 cell-conditioned medium to induce proliferation of microglial cells. Cells proliferated at days 5–10 after plating. To immortalize the cells, they were re-plated and infected with v-raf/v-myc retrovirus (J2-conditioned medium [
20]), supplemented with 30 % L929-conditioned media and 4 μg/mL polybrene. The next day, the medium was replaced by DMEM (4.5 g/L glucose), 10 % FBS, and 1 % P/S.
Flow cytometry
IMG cells were grown on a 10-cm tissue culture dish until 80 % confluent. After addition of 5 mL fresh media, cells were lifted off the dish using a cell scraper. IMG cells were resuspended to 1 × 108 cells/mL and incubated with fluorescently conjugated CD11b (Alexa 647 conjugate; Serotec), F4/80 (allophycocyanin (APC) conjugate; Caltag), or appropriate isotype control (BioLegend) antibodies (1:10 dilution) in the dark for 15 min at 4 °C. Cells were then washed three times with 2 mL cell-staining buffer (BioLegend). After washing, cells were resuspended in cell-staining buffer and were analyzed by flow cytometry (FACSCalibur, BD Biosciences). Acquired data were analyzed using FlowJo data analysis software (FlowJo, LLC).
Fluorescence microscopy
IMG and SH-SY5Y cells grown on poly-d-lysine-coated coverslips were fixed for 20 min with 4 % formaldehyde at 4 °C in PBS containing 0.5 mM MgCl2 and 1 mM CaCl2 (PBS++). Cells were then permeabilized with 0.5 % Triton-X100 in PBS++ for 5 min at room temperature. After blocking with 1 % bovine serum albumin (BSA) and 0.3 M glycine in PBS++ for 1 h at room temperature, cells were incubated for 1 h at room temperature with anti-NeuN (Millipore, MAB377) (1:100), anti-F4/80 (Caltag, MF48020) (1:100), or anti-CD11b (Serotec) (1:100). Cells were then washed and incubated for 1 h at room temperature with Alexa Fluor 568-conjugated anti-rabbit or anti-mouse antibody (1:1000, Invitrogen) in 1 % BSA in PBS++. Coverslips were mounted onto glass slides using DakoCytomation fluorescent mounting medium (Carpinteria, CA). Images were obtained using a Zeiss AxioImager Z1 Axiophot wide-field fluorescence microscope and were analyzed by Zeiss AxioVision software (Zeiss, Thornwood, NY).
Immunoblot
IMG and C6 glioma cells were incubated for 24 h in full growth medium plus 100 ng/mL IL-6 to allow for astrocytic differentiation of C6 glioma cells [
21]. For cytosolic protein extracts, cells were lysed in hypotonic buffer using 1 % NP-40 plus protease inhibitors (Calbiochem Cat. No. 539134; 1:100 dilution) on ice followed by centrifugation to separate the remaining nuclei (pellet) from the cytosolic fraction (supernatant). The nuclei-containing pellets were lysed with RIPA buffer plus protease inhibitors for 30 min on ice. Protein concentration was determined, and 30–50 μg of protein/sample was heated for 5 min at 95 °C, cooled on ice, and then resolved on a 4–15 % SDS-PAGE gel (10 % SDS-PAGE gel used for cytosolic and nuclear extracts). The protein was transferred onto a nitrocellulose membrane (0.2 μm) using a Trans-blot turbo transfer system (Bio-Rad, Hercules, CA). The resulting membrane was blocked for 1 h at room temperature in TBST (Tris-buffered saline plus 0.05 % Tween-20) plus 5 % milk. After three washes with TBST, the membrane was incubated with primary mouse monoclonal GFAP (GA5) antibody (1:1000 dilution; Cell Signaling Technology, Beverly, MA), rabbit monoclonal NeuN antibody (1:1000 dilution; Abcam Inc., Cambridge, MA), rat monoclonal F4/80 antibody (1:10,000 dilution; AbD Serotec), rabbit polyclonal β-tubulin antibody (1:500; Abcam), or rabbit monoclonal Lamin B1 antibody (1:10,000 dilution; Abcam) in TBST plus 5 % milk overnight at 4 °C. The membrane was washed three times with TBST and then was incubated for 1 h at room temperature with IRDye 800CW donkey anti-mouse or anti-rabbit IgG (1:5000 dilution; Li-Cor, Lincoln, NE) in TBST 5 % milk (anti-rat HRP 1:5000 dilution was used to probe for F4/80 primary antibody). The membrane was washed three times with TBST and was imaged using Li-Cor Odyssey 2.1 infrared detection technology.
Quantitative RT-PCR
Total RNA was extracted from IMG or BV-2 cells using TRIzol reagent (Invitrogen, Carlsbad, CA) as per the manufacturer’s instructions. For analysis of adult microglial markers, microglia were pre-incubated for 5 days in full growth medium plus mouse recombinant carrier-free MCSF (10 ng/mL; R&D Systems) and recombinant TGFβ1 (50 ng/mL; Miltenyi Biotec) as described [
26]. RNA was purified and on-column DNAse treated using the Direct-zol RNA Miniprep Kit from Zymo-research (Irvine, CA) as per the manufacturer’s instructions. Purified RNA was then reverse-transcribed using the SuperScript® III First-Strand Synthesis System (Invitrogen) along with oligo(dT)20 primers and random hexamers. Quantitative PCR was performed using iTaq Universal SYBR green Supermix (Bio-Rad, Hercules, CA) and the StepOnePlus Real-Time PCR System (Life Technologies, Grand Island, NY). In all cases, 36B4 was used as an internal control. Primers used for quantitative PCR (qPCR) are listed in Table
1.
Table 1
Primer list used for qPCR
Mouse 36B4 | AGATGCAGCAGATCCGCAT | GTTCTTGCCCATCAGCACC |
Mouse iNOS | GTTCTCAGCCCAACAATACAAGA | GTGGACGGGTCGATGTCAC |
Mouse TNF-α | AAATGGCCTCCCTCTCATCAG | GTCACTCGAATTTTGAGAAGATGATC |
Mouse IL-1β | AGCTTCAGGCAGGCAGTATC | AAGGTCCACGGGAAAGACAC |
Mouse Arg-1 | CACAGTCTGGCAGTTGGAAG | GGGAGTGTTGATGTCAGTGTG |
Mouse Mgl1 | GCGAAGGCTTACAATGATATACGAAAACCTCC | GCGCTCAGACGAGAGCTCCTAGCTCTCC |
Mouse Ym1 | AGAAGGGAGTTTCAAACCTGGT | GTCTTGCTCATGTGTGTAAGTGA |
Mouse Itgb5 | CTCCAGGGCCCGTTATGAAA | AGGCGAAATCGACAGTGTGT |
Mouse Tgfb1 | AGGGCTACCATGCCAACTTC | CCACGTAGTAGACGATGGGC |
Mouse Fcrls | AAGTGCGTTTGGTGAATGGC | CACAGCCACATCCCTCATGT |
Mouse Sall1 | TGCTGACCAACGACTCTTCC | ACTGGGGTGGGAGATAGACC |
Enzyme-linked immunosorbent assays
Mini enzyme-linked immunosorbent assay (ELISA) development kits (Peprotech, Rocky Hill, NJ) were used to detect murine TNF-α, IL-6, and IL-1β expression by IMG cells. Buffers used throughout this protocol were purchased as an ELISA Buffer Kit from Peprotech (Catalog #900-K00). Briefly, IMG cells were incubated for 16 h with either LPS (10 ng/mL) or IL-4 (10 ng/mL) in a six-well tissue culture dish. Alternatively, IMG cells were incubated for 6 h with or without LPS (10 ng/mL) in 1 mL of full growth media at 37 °C 5 % CO2. Ac-YVAD-CMK (40 μM) was then added to the appropriate wells for 5 min prior to the addition of ATP (5 mM) for 30 min. After the 6- or 16-h incubation, the conditioned media were collected and the cells were washed three times with PBS and were lysed for 30 min at 4 °C with 1 % NP-40 plus protease inhibitors. Appropriate capture antibody was adhered to wells of a 96-well plate overnight at room temperature. After repeated washes, the wells were blocked with 1 % BSA in PBS for 1 h at room temperature followed by multiple washes. For each condition, 100-μL aliquots of cell lysates were added to each well in triplicate for 2 h at room temperature. The plate was washed repeatedly, and detection antibody (0.5 μg/mL) was added and incubated for 1 h at room temperature. Plates were washed and incubated with avidin-HRP conjugate (1:2000 dilution) for 30 min at room temperature. Lastly, the plates were washed, and 2,2′-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS) liquid substrate was added to each well. Color development (405 nm) was monitored using a BioTek Synergy 2 spectrophotometer (Winooski, VT).
IL-1β immunoblot
IMG cells in a six-well poly-d-lysine-coated tissue culture dish were treated for 6 h with or without LPS (10 ng/mL) in 1 mL of full growth media at 37 °C 5 % CO2. Ac-YVAD-CMK (40 μM) was then added to the appropriate wells for 5 min prior to the addition of ATP (5 mM) for 30 min. The IMG cell-conditioned media were then collected and concentrated ten times from 1 mL to 100 μL using a 10K MWCO Nanosep Omega centrifugal device (PALL, Ann Arbor, MI). Seven microliters of this media was heated at 95 °C for 5 min and then resolved on a 4–20 % SDS-PAGE gel. The protein was then transferred onto a 0.2-μm nitrocellulose membrane using a wet-transfer apparatus at 100 V for 60 min. The membrane was blocked with 5 % milk in TBST at 4 °C for 1 h prior to incubation overnight at 4 °C with goat polyclonal IL-1β antibody (1:500 dilution; Santa Cruz Biotechnology, Inc.). The membrane was washed three times with TBST and then was incubated for 1 h at room temperature with IRDye 800CW donkey anti-goat IgG (1:5000 dilution; Li-Cor) in TBST 3 % milk. The membrane was washed three times with TBST and was imaged using Li-Cor Odyssey 2.1 infrared detection technology.
Phagocytosis assays
IMG cells were seeded into two six-well tissue culture plates (0.5 × 106 cells/well) and allowed to adhere for 2 h, after which time the media were exchanged with fresh media to remove non-adherent cells. IMG cells were allowed to grow for 16 h at 37 °C/5 % CO2 prior to the start of the assay. Sixty-five-microliter aliquots of carboxylate-modified polystyrene fluorescent yellow-green latex beads (YG beads) (Sigma Aldrich, Cat# L4655) were diluted in 6.5-mL aliquots of pre-warmed (37 °C) or pre-chilled (4 °C) growth media. Media were removed from IMG cells, and 1 mL of YG bead-containing media was added to each well. IMG cells were immediately incubated at 37 °C or chilled at 4 °C for 1 h. The remaining steps were strictly performed on ice. To remove non-internalized beads, cells were washed five times with 2 mL/well ice-cold PBS. After washing, the IMG cells were incubated with 2 mL/well ice-cold PBS containing 2 mM EDTA for 10 min at 4 °C. Cells were removed from the dish by titration and transferred to 15-mL conical tubes. Cells were collected by centrifugation at 300×g for 6 min at 4 °C. Cell pellets were resuspended in PBS containing 2 mM EDTA. IMG cell-acquired YG beads were quantified by flow cytometry, and data were analyzed.
Amyloid-beta assays
Amyloid-beta (1–42), FITC-amyloid-beta (1–42), and scrambled amyloid-beta (1–42) were purchased from rPeptide (Bogart, GA). Briefly, HFIP-prepared peptide was resuspended with DMSO (0.1 mg in 10 μL) and then diluted 1:10 with Ham’s F-12 nutrient mix and incubated for 24 h at 4 °C as described [
22,
23]. Both oligomeric and fibrillar Aβ
1–42 were detected by dot blot analyses using species-specific antibodies (Additional file
1: Figure S1). IMG phagocytosis of FITC-Aβ was performed using cells seeded into a 96-well black-walled amine-coated tissue culture plate. Cells were incubated with FITC-Aβ
1–42 (1 μM) at 37 °C 5 % CO
2 for the times indicated in full growth medium. Cells were placed on ice and washed five times with ice-cold PBS
++. One hundred microliters of PBS
++ was added to each well, and FITC fluorescence was measured using a plate reader (excitation 494 nm, emission 521 nm).
Indirect immunofluorescence was used to determine subcellular localization of FITC-Aβ. IMG cells grown on glass coverslips were incubated for 1 h with FITC-Aβ and processed for fluorescence microscopy as described above. Briefly, cells were incubated with primary antibody targeting lysosomal-associated membrane protein 1 (LAMP1) (Pharmingen; 1:100 dilution). Secondary anti-rat rhodamine red antibody (JacksonImmuno Research; 1:1000 dilution) was used. Each antibody treatment was performed at room temperature for 1 h in 1 % BSA PBS++. Cells were then washed, mounted, and imaged as described above. Co-localized pixels were determined using ImageJ 1.48v software (National Institute of Health, USA).
Statistical analysis
One-way ANOVA followed by Tukey’s multiple comparison test was used where indicated. Two-way ANOVA followed by Dunnett’s multiple comparison test was used where indicated. Paired t test statistical analysis was used where indicated. Statistical analyses were performed using Prism GraphPad version 6.00 for Windows, GraphPad Software, La Jolla, CA, USA.
Discussion
Chronically activated pro-inflammatory adult microglial cells contribute to the progression of neurodegenerative diseases like Alzheimer’s and Parkinson’s diseases [
4,
5,
9,
10]. An adult immortalized microglial cell model system for examination of neuroinflammation is therefore essential. BV-2 cells, a currently used model system, were generated using mononuclear cells from an embryonic mouse brain. A major drawback is the limited BV-2 cell response to pro- and anti-inflammatory stimuli (Fig.
6) [
14,
15,
29‐
31]. On the other hand, primary adult microglial cell isolation yields a limited number of cells, can be technically challenging with potential cell activation, and suffers from a lack of homogeneity.
Here, we describe the development of a novel immortalized adult microglial cell line, IMG cells, which share phenotypic attributes with primary adult microglia and respond robustly to inflammatory signals. Primary adult microglia react to changes in their extracellular environment by polarizing to a reactive phenotype or one that promotes resolution of inflammation [
10,
36]. IMG cells are far more responsive than BV-2 cells to external pro- and anti-inflammatory signals such as LPS and IL-4. The fact that IMG cells display a robust response to external pro- and anti-inflammatory stimuli make this an ideal model system to examine microglial involvement in neurodegenerative diseases, such as Alzheimer’s disease, where a link between chronic microglial activation and the progression of the disease has been well established [
5,
37].
In the early stages of Alzheimer’s disease, brain microglia become activated by Aβ peptides which, in turn, are cleared by the microglia via phagocytosis [
11,
38‐
40]. The activation of microglia by Aβ peptides increases secretion of pro-inflammatory cytokines, which can reduce microglial cell Aβ peptide receptor expression via an autocrine feedback loop [
38,
41]. The reduced expression of Aβ receptors by microglia results in reduced clearance, thus promoting plaque formation to persist and disease progression to continue. Secretion of pro-inflammatory cytokines by activated microglia also promotes neuronal cell damage and death. It is therefore important to understand microglial cell function, especially Aβ-induced activation and phagocytosis, in order to develop new therapies aimed at targeting these pro-inflammatory effects. We have developed and characterized the IMG cell line to advance towards these goals.
Taming the chronic pro-inflammatory polarization of microglia in Alzheimer’s disease is one therapeutic strategy that is actively investigated [
2]. In the past, BV-2 cells have been used to screen for potential anti-inflammatory drugs to quell or negate the effect of LPS [
30]. Our experiments show that the IMG cells’ response to inflammatory factors is far greater than that of BV-2 cells, raising the promise of their utility in such screening efforts. Moreover, IMG cells are highly reactive to Aβ, establishing an in vitro model relevant to Alzheimer’s disease. To explore their potential use in pharmacological studies, we established that the cannabinoids THC and JWH-015 limit Aβ-induced IMG cell inflammation. The mechanism of anti-inflammatory action of cannabinoids has yet to be established, but our studies suggest CB2 activation by the selective agonist JWH-015 is sufficient to mediate this effect. In preliminary experiments, we have determined that cannabinoids do not alter Aβ uptake or degradation by IMG cells (data not shown). CB2 may elicit downstream signals to reduce the Aβ-induced inflammatory response in IMG cells. Potential targets include elements of the peroxisome proliferator-activated receptor-γ (PPAR-γ) pathway [
42]. Further investigation is required to determine the exact mechanism of cannabinoid drug action on IMG cells and to employ these cells to screen for new drug candidates that ameliorate Aβ-induced inflammation.
Conclusions
We have established an immortalized cell line from adult murine microglia. We conclude this model system, called IMG for immortalized microglia, fully recapitulates morphological and functional characteristics of brain microglia. IMG cells express microglia-specific markers and respond appropriately to pro- and anti-inflammatory stimuli. IMG cells phagocytose foreign particles. Moreover, IMG cells are robustly activated by Aβ1–42, which they also phagocytose. The response of IMG cells to extracellular pro- and anti-inflammatory stimuli, including Aβ, is far greater than the most commonly employed microglial BV-2 cell line. As an example of their potential utility, we demonstrate administration of cannabinoids can effectively alleviate Aβ activation of IMG cells. This cell line provides a new platform to explore drug interactions and gain mechanistic information about neuroinflammatory responses underlying Alzheimer’s disease and other neurological disorders.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
D-YL and C-HL isolated the primary microglia, generated the IMG cell line, and obtained the phase-contrast images for each. AA designed and carried out the cytokine panel experiments on the IMG cells used for the qPCR analysis. AMG performed all of the qPCR and flow-cytometry analyses. RCM wrote the manuscript, participated in the study’s design and coordination, and performed the flow-cytometry, ELISA, western blot, indirect immunofluorescence, phagocytosis, BV-2, and Aβ analyses. MW-R and C-HL conceived the study, participated in its design and coordination, and helped to draft the manuscript. All authors read and approved the final manuscript.