Background
Bladder cancer is the ninth most common malignant tumor worldwide and ranks 13th in cancer-related mortality every year. There were approximately 430,000 new-onset cases in 2012 [
1‐
4]. Bladder cancer can be classified into non-muscle-invasive and muscle-invasive bladder cancer according to the depth of tumor infiltration [
5,
6]. Although timely surgical intervention and chemotherapy can restrict the progression and development of tumors, the 5-year overall survival rate of muscle-invasive bladder cancer patients is 60% due to distant metastasis [
7]. Therefore, clarification of the molecular mechanisms underlying bladder cancer progression to discover novel and precise therapeutic targets and improve the prognosis of bladder cancer is meaningful.
In recent decades, numerous studies have confirmed the crucial roles of the Hippo pathway in tissue homeostasis, cell proliferation, apoptosis and multiple other biological processes. Surprisingly, impairment of the Hippo pathway leads to remarkable impacts on cancer development, angiogenesis, progression, metabolic phenotype and ROS buildup [
8‐
15]. Moreover, emerging studies have demonstrated the regulatory roles of components of the Hippo signaling pathway in the EMT process [
16‐
20]. EMT plays essential roles during normal mammalian development, in which epithelial cells acquire mesenchymal features. However, EMT is also associated with tumorigenesis and metastasis and is essential in cancer progression [
21‐
23]. Therefore, EMT-related signaling pathways have been a novel focus in studies related to cancer therapy in past decades [
24‐
27].
The core of the Hippo pathway is composed of a kinase cascade, transcriptional coactivators, and DNA-binding partners. The pathway is regulated by intrinsic cellular machinery and various cellular signals [
28]. The upstream serine/threonine kinases MST1/2 (mammalian sterile twenty-like) can phosphorylate and activate LATS1/2 (large tumor suppressor) via a complex formed with the adaptor protein Sav1. Then, activated LATS1/2, together with MOB1, suppresses the transcriptional coactivator TAZ or its paralog YAP (Yes-associated protein) through phosphorylation [
29]. TAZ interacts with the TEA domain DNA-binding (TEAD) family of transcription factors to recruit these transcription factors to their target promoters and regulate gene expression [
30]. In mammals, the transcriptional activation of TEADs requires transcriptional coactivators, such as TAZ, YAP and the p160 family of nuclear receptor coactivators [
31].
MicroRNAs regulate the levels of protein-coding genes by binding to specific mRNA sequences [
32]. A growing number of studies have reported that microRNAs are involved in multiple aspects of biological cellular processes, including cancer development and progression, making them novel therapeutic targets [
27,
33,
34]. Moreover, the dysregulation of miRNAs and their influences on tumorigenesis, development, and progression have been discovered in bladder cancer [
35,
36].
GAS1 is a well-known cell growth suppressor [
37] and is involved in tumorigenesis and progression [
38‐
40]. Aberrant expression of GAS1 reduces tumorigenicity in human brain tumor-initiating cells [
41], while downregulation of GAS1 expression is a potential biomarker of clear cell renal cell carcinoma [
42]. Interestingly, GAS1 has been reported to serve as a novel biomarker and inhibit proliferation, angiogenesis, EMT and glycolysis in human cancers [
43,
44].
In the current study, we investigated the abundant expression of TAZ in both bladder cancer cell lines and bladder cancer tissues. In addition, TAZ knockdown impaired proliferation, angiogenesis, EMT, glycolysis and redox homeostasis in bladder cancer cells. Mechanistically, we identified a positive feedback loop between TAZ and miR-942-3p that enhanced upstream signaling and modulated biological and metabolic phenotypes and ROS levels by regulating GAS1 expression. Collectively, our results indicate that TAZ, miR-942-3p and GAS1 are novel therapeutic targets that could be exploited for clinical intervention in bladder cancer.
Materials and methods
Ethical approval
All animal experiments were approved by the Ethics Committee of The First Affiliated Hospital, School of Medicine, Zhejiang University and were carried out according to the guidelines of the Guide for the Care and Use of Laboratory Animals published by the NIH.
Clinical tissue specimens
Clinical tissue specimens and paired normal bladder tissue specimens were acquired from surgical specimens. All patients included in the study provided written informed consent. All specimens were histologically characterized by pathologists according to the World Health Organization Consensus Classification and TNM staging system for bladder neoplasms. The study was approved by the Ethics Committee of The First Affiliated Hospital of the Zhejiang University School of Medicine. Detailed information on the patients is listed in Tables S1 and S2 in Supplemental File
1.
Cell lines and culture
SV-HUC-1 cells, HEK-293 T cells, HUVECs and the human bladder cancer cell lines 5637, J82, T24, EJ, TCCSUP, RT4 and UM-UC-3 were acquired from the American Type Culture Collection. HEK-293 T cells, J82 cells and HUVECs were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, and the other cells mentioned above were cultured in RPMI-1640 medium.
RNA extraction and quantitative real-time PCR
Total RNA was extracted with TRIzol Reagent (Invitrogen, CA, USA). For mRNA detection, the PrimeScript RT Reagent Kit (Takara Bio Inc., China) was used for mRNA reverse transcription. qRT-PCR was performed by utilizing TB Green Premix Ex Taq II (Takara Bio Inc., China) with a QUANT5 PCR system (Applied Biosystems, USA). The normalized control for mRNA expression analysis was GAPDH. An All-in-One miRNA qRT-PCR detection kit (GeneCopoeia, USA) was used for miRNA detection, with human U6 as the endogenous control. The primers used were as follows: TAZ: Fwd, 5′-ACCCGCGAGTACAACCTTCTT-3′, and Rev., 5′-TATCGTCATCCATGGCGAACT-3′; E-cadherin: Fwd, 5′- CTGTGCCCAGCCTCCATGTTTT − 3′, and Rev., 5′- CTGGATAGCTGCCCATTGCAAGTTA − 3′; N-cadherin: Fwd, 5′- GCTTATCCTTGTGCTGATGTTT − 3′, and Rev., 5′- GTCTTCTTCTCCTCCACCTTCT − 3′; Vimentin: Fwd, 5′- CAGGATGTTGACAATGCGT − 3′, and Rev., 5′- CTCCTGGATTTCCTCTTCGT − 3′; Fibronectin: Fwd, 5′- TTATGACGACGGGAAGACCT − 3′, and Rev., 5′- GCTGGATGGAAAGATTACTC − 3′; Snail: Fwd, 5′- ATGCACATCCGAAGCCACA − 3′, and Rev., 5′- TGACATCTGAGTGGGTCTGG -3′; PFKFB3: Fwd, 5′- GTGCCTTAGCTGCCTTGAGA − 3′, and Rev., 5′- CCGACTCGATGAAAAACGCC -3′; LDHB: Fwd, 5′- TGGTATGGCGTGTGCTATCAG − 3′, and Rev., 5′- TTGGCGGTCACAGAATAATCTTT -3′; HK2: Fwd, 5′- GATTGTCCGTAACATTCTCATCGA − 3′, and Rev., 5′- TGTCTTGAGCCGCTCTGAGAT -3′; GLUT1: Fwd, 5′- CTTTGTGGCCTTCTTTGAAGT − 3′, and Rev., 5′- CCACACAGTTGCTCCACAT -3′; GLUT3: Fwd, 5′- AAAGTCCCTGAGACCCGTGGCAGG − 3′, and Rev., 5′- AAGATCCAAACCGCAGCCTTG -3′; GLUT4: Fwd, 5′- TGGAAGGAAAAGGGCCATGCTG − 3′, and Rev., 5′- CAATGAGGAATCGTCCAAGGATG -3′; GAPDH: Fwd, 5′-GATATTGTTGCCATCAATGAC-3′, and Rev., 5′-TTGATTTTGGAGGGATCTCG − 3′; miR-942-3p: CACATGGCCGAAACAGAGAAGT. Data analysis of relative expression levels was performed using the 2-ΔΔCt method. In detail, ΔCt = Ct (target gene)-Ct (GAPDH) and ΔΔCt = ΔCt (Group A)-ΔCt (Group B).
siRNA, plasmid and lentivirus
siRNAs and TAZ, TEAD2, miR-942 promoter and GAS1 plasmids were constructed and obtained from Transheep (Shanghai, China). A miR-942-3p mimic was synthesized by RiboBio (Guangzhou, China). siRNA was transfected with Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen, USA), while plasmids were transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen, USA) according to the manufacturer’s instructions. Lentivirus-pre-miR-942, lentivirus-miR-942-3p-sponge and lentivirus-shTAZ were all purchased from GeneChem (Shanghai, China). Cells were transduced with lentiviruses and selected with puromycin for 1 week.
Chromatin immunoprecipitation (ChIP)
The SimpleChIP® Plus Enzymatic Chromatin IP Kit (Catalog# 9004, Cell Signaling Technology, USA) was utilized for a ChIP assay according to the manufacturer’s instructions. Briefly, 293 T cells (4 × 106) were fixed with formaldehyde and lysed, and chromatin was fragmented by digestion with Micrococcal nuclease to obtain fragments of 1–5 nucleosomes. Chromatin immunoprecipitation was performed using 2 μg antibodies and Protein G Agarose Beads with incubation overnight at 4 °C with rotation. The eluents from the immunoprecipitants were used for reversal of cross-linking. Then, we purified DNA and performed qRT-PCR with specific primers. The sequences of the primers for the miR-942 promoter were as follows: Primer-1: Fwd, 5′-TTTGCTCCCTTGACTCCCAGC-3′, and Rev., 5′-GGTCAAAGCACTGAGCTGTTCTT-3′; Primer-2: Fwd, 5′-ATTGCACTGAAGTGGGTTTTCTGT-3′, and Rev., 5′- GACACAGTCTCTAGAGTCAAGCCT-3′; Primer-3: Fwd, 5′-CTTCAGAGTGAGCTATTGGGCTAAAAT-3′, and Rev., 5′-CCTTCCCTACTTGAAACAACCGTATG-3′; Primer-4: Fwd, 5′-CCTTCAGAGTGAGCTATTGGGC-3′, and Rev., 5′-CCTTCCCTACTTGAAACAACCGT-3′; and Primer-5: Fwd, 5′-CCAGCCATATGAGGACAGAGGAAG-3′, and Rev., 5′-CTTTCAAGAGCCTCTAAGGGCCC-3′.
Luciferase reporter assay
To verify the transcriptional activity of TAZ-TEAD at the miR-942 promoter, 293 T cells were plated in 96-well plates (5000 cells per well) and cotransfected with a firefly luciferase plasmid containing the miR-942 promoter, a TEAD2 plasmid and a TAZ plasmid (Transheep, China). pRL-CMV Renilla luciferase was also cotransfected to normalize luciferase activity. The ratio of TAZ plasmid: TEAD2 plasmid: miR-942 luciferase: Renilla: transfection reagent was 0.25 μg: 0.25 μg: 0.25 μg: 0.005 μg: 0.2 μL (per well), and every test was performed in triplicate. Plasmids were transfected with Lipofectamine™ 3000 Transfection Reagent (Invitrogen, USA). Cells were harvested after 48 h, and a dual-luciferase reporter assay detection kit (Promega, USA) was used for cell luciferase activity detection.
To confirm the relationships between miR-942-3p and GAS1 or LATS2, luciferase reporter vectors (pGL3-Firefly_Luciferase-Renilla_Luciferase) containing the full-length 3′-UTR of GAS1 or LATS2 were constructed, and mutant vectors were also generated (GeneChem, China). Two hundred ninety-three T cells were seeded and cotransfected with a luciferase vector and miR-942-3p mimic or negative control. The cells were harvested after 48 h, and a dual-luciferase reporter assay detection kit (Promega, USA) was used to measure firefly and Renilla luciferase activities. The final result = firefly luciferase intensity/Renilla luciferase intensity. All assays were performed independently at least three times.
HUVECs were seeded in a 96-well plate (2 × 104 per well) precoated with Matrigel (BD Biosciences, USA). Conditioned medium (CM) acquired from different cells was added into the wells, and the plate was incubated for 6 h. The formation of tubes was observed by phase-contrast microscopy (Nikon, Japan) and quantified by ImageJ in three randomly selected fields.
Migration and invasion assays
Migration and invasion chambers (Costar, NY, USA) were used in migration and invasion assays. Briefly, 3 × 104 cells in serum-free medium were seeded in the upper chambers. Specifically for the invasion assay, upper chambers precoated with Matrigel (BD Biosciences, USA) were used. Medium containing 10% fetal bovine serum was added to the bottom chambers. Migrated and invaded cells were fixed with 4% formalin for 15 min and stained with crystal violet for another 15 min. The stained cells were observed and counted by microscopy (Nikon, Japan) in three randomly selected fields.
Wound healing assay
Seventy microliters of bladder cancer cell suspension was plated in a well containing Culture-Insert (Ibidi, Germany) according to the manufacturer’s instructions. After 24 h, Culture-Inserts were removed, and the cells were incubated in serum-free medium. Photos were captured at 0 and 24 h after insert removal, and the migration rate of the cells was measured and analyzed with ImageJ software.
Apoptosis analysis
Cells under different conditions were seeded in a 6-well plate. After 24 h of incubation, the cells were collected and stained with an Annexin V-FITC/propidium iodide (PI) kit (BD Biosciences, USA). After an incubation for 15 min at room temperature, the apoptotic rate of the cells was detected by flow cytometry (Becton Dickinson, USA).
Detection of intracellular ROS
Intracellular ROS levels were determined by using DCFH–DA (Sigma, MO, USA). Specifically, cells that received various treatments were incubated with DCFH–DA (5 μM) in serum-free medium for 30 min at 37 °C. After washing three times with PBS, the level of ROS was detected and analyzed by flow cytometry (Becton Dickinson, USA).
Western blot analysis and antibodies
Total protein was by using RIPA buffer (C1053, APPLYGEN, Beijing, China), and the protein concentration was determined by using a BCA protein assay kit (Beyotime, China). Proteins were then separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, MA). After blocking for 2 h in 5% milk, membranes were washed with TBST 3 times and incubated with primary antibodies at 4 °C overnight. The membranes were then incubated with a secondary antibody (anti-mouse or anti-rabbit IgG, Cell Signaling Technology, USA) for 1 h at room temperature. After 3 washes with TBST, a Bio-Rad detection system was used to detect the bands. The antibodies used in this study were as follows: anti-GAPDH (5174), anti-TAZ (70148), anti-E-cadherin (3195), anti-Snail (3879), anti-N-cadherin (13116), anti-Vimentin (5741) and anti-Fibronectin (26836) were all obtained from Cell Signaling Technology. Anti-LATS2 (ab110780), anti-GAS1 (ab236618), anti-PFKFB3 (ab181861), anti-HK2 (ab209847) and anti-GLUT1 (ab115730) were all obtained from Abcam.
Glycolysis process evaluation
The uptake of glucose into different cells was evaluated with the Glucose Uptake Colorimetric Assay Kit (BioVision, CA, USA). In detail, 1 × 104 cells per well were seeded in a 96-well plate. To evaluate glucose uptake, the cells were starved in 100 μl serum-free medium overnight and then preincubated with 100 μl Krebs-Ringer-Phosphate-Hepes (KRPH) buffer containing 2% BSA for 40 min. Then, 10 μl 10 mM 2-DG was added and incubated for 20 min. The cells were lysed to degrade endogenous NAD(P) and denature enzymes and then heated at 85 °C for 40 min. The cell lysates were cooled on ice for 5 min. Finally, the absorbance was measured by using a microplate reader. The production of lactate was detected by using a lactate colorimetric assay kit (BioVision, CA, USA). Briefly, cells were homogenized in assay buffer. After centrifugation to remove insoluble materials, 50 μl was added to each well of a 96-well plate. Fifty microliters of reaction mix was added to each well, and the plate was incubated for 30 min at room temperature. The absorbance was measured by using a microplate reader, and the lactate concentration was calculated.
Other in vitro experiments
CCK-8 and colony formation assays and HE staining were performed according to previously described methods [
27].
In vivo studies
To establish a xenograft tumorigenesis model, 5 × 106 T24 cells that received different treatments were injected subcutaneously into nude mice. The mice were sacrificed, and the tumors were excised, weighed, and fixed with formalin for immunohistochemical examination 25 days later. Tumor volume was measured daily and calculated according to the following formula: Total tumor volume (mm3) = L × W2/2 (“L” = length and “W” = width). All animal-related procedures were approved by the Animal Care and Use Committee of The First Affiliated Hospital of the School of Medicine of Zhejiang University.
Statistical analysis
All data are expressed as the mean ± standard deviation (SD) and were analyzed with SPSS. A paired t-test was used to analyze differential expression in both cells and tissues. A two-tailed p-value < 0.05 was regarded as statistically significant in this study.
Discussion
TAZ is a key executor of the Hippo signaling pathway that regulates cellular proliferation, differentiation and tissue homeostasis [
49,
50]. In recent decades, a great deal of evidence has indicated that dysregulation of TAZ contributes to cancer initiation and progression [
51,
52]. The present study confirmed that TAZ was overexpressed in bladder cancer cell lines and tissue and related to cell survival, proliferation, migration and invasion.
The Hippo pathway has emerged as an important upstream signaling pathway in angiogenesis [
53]. In detail, TAZ has been reported to be involved in VEGF-induced endothelial cell sprouting [
54]. In addition, TAZ also enhances angiogenesis in EGFR wild-type non-small cell lung cancer cells [
55]. According to these findings, we further evaluated the angiogenesis-inducing ability of conditioned medium acquired from control or TAZ-depleted cancer cells, and the results indicated TAZ has a key role in angiogenesis. However, the underlying molecular mechanism related to this interaction is worth investigating.
EMT is a transdifferentiation program in which epithelial cells acquire mesenchymal features. Interestingly, recent studies have indicated that EMT state regulates tumor migration, invasion, metastasis and resistance to clinical therapy. Moreover, EMT may lead to the emergence of cancer stem cells and trigger tumor initiation [
16,
18,
21,
23,
56]. The Hippo signaling pathway has been reported to regulate the EMT process and mesenchymal characteristics [
57‐
60]. In light of this, we examined EMT markers such as E-cadherin, Vimentin, N-cadherin, Fibronectin and Snail and found that TAZ knockdown reversed the EMT process. It is well known that numerous pathways and factors are involved in the modulation of EMT; therefore, further study is needed to validate the exact regulatory mechanism of the TAZ-induced EMT process.
TAZ and the Hippo pathway also participate in metabolic modulation, such as regulating glycolysis, lipogenesis, and glutaminolysis [
10‐
14]. Interestingly, a growing body of evidence has verified that glycometabolism may modulate cell growth, migration and progression in bladder cancer [
61‐
63]. While normal cells acquire energy for physiological processes from the oxidation of pyruvate, cancer cells rely on aerobic glycolysis to generate energy and compounds to support their aberrant growth and metastasis. This metabolic characteristic of cancer cells is termed the Warburg effect. The Warburg effect not only ensures an adequate supply of energy and nutrients but also provides an acidic microenvironment that enhances migration and invasion [
64]. Therefore, clarification of the underlying mechanism of glycolysis in bladder cancer for clinical intervention and treatment is a meaningful pursuit. Our current results suggest that TAZ is vital for glycolysis in bladder cancer cells and functions by regulating the expression of PFKFB3, HK2 and GLUT1, which serve as key components in glycolysis. However, the deeper interactions between glycolysis and other biological effects mediated by TAZ are worth exploring and verifying in future studies.
Of note, redox homeostasis can be disrupted by TAZ inhibition-induced metabolic reprogramming in NF2-mutant tumor cells [
14]. In the current study, apart from the suppression of glycolysis, ROS levels were remarkably elevated after TAZ knockdown in bladder cancer cells. A previous study reported that ROS stress could trigger a DNA damage response mediated by p53, inhibiting the proliferation and growth of tumor cells [
65]. Therefore, it is reasonable to deduce that the elevated ROS levels may play a crucial role in the TAZ-induced alterations in biological behaviors. In future studies, we will investigate ROS stress-related signaling pathways and the interaction between ROS and biological functions in TAZ-depleted bladder cancer cells.
The TEAD protein family consists of four paralogous factors that function as nuclear DNA-binding proteins to modulate the transcriptional activity of downstream genes in response to the Hippo signaling pathway. Of note, the modulatory role of TEAD proteins depends on binding with TAZ or YAP in the nucleus, whose nuclear import is mediated by LATS1/2 [
30,
31,
47]. MiRNAs participate in numerous biological processes, including tumor initiation, progression and metastasis [
27,
34‐
36,
66]. Nevertheless, the mechanism underlying the dysregulated miRNAs in bladder cancer remains unclear. Therefore, we speculated that TAZ may exert its biological functions by enhancing the expression of miRNAs and, following miRNA sequencing, qRT-PCR, ChIP and luciferase reporter assays, illustrated that miR-942-3p is regulated by TAZ-TEADs in bladder cancer cells.
MiR-942 has been confirmed to play key roles in tumorigenesis and angiogenesis [
45,
46,
67]. Our results showed that miR-942-3p was abundantly expressed in bladder cancer cell lines and tissue and served as a tumor promoter. Moreover, GAS1 and LATS2 were verified as direct downstream targets of miR-942-3p. LATS2 suppresses the transcriptional activation of Hippo pathway-related genes by phosphorylating TAZ [
9,
28,
47]. GAS1 acts as a novel biomarker and inhibits proliferation, angiogenesis, EMT and glycolysis in human cancers [
43,
44]. Based on previous studies and these results, our further experiments identified a positive feedback loop between TAZ and miR-942-3p that affects the biological impacts of GAS1.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.