Periostin gene expression in neu-positive breast cancer cells is regulated by a FGFR signaling cross talk with TGFβ/PI3K/AKT pathways

MMTV-NeuNDL [34], MMTV-NIC [35] and MMTV-PyMT [36] transgenic mice were a kind gift from Dr. William Muller (McGill University). Postn-null mice [37] were a kind gift from Dr. Simon J. Conway. Female mice only were used for all experiments. Mice were palpated twice a week to assess onset, progression and endpoint. Tumor onset was defined by a volume of 0.5 cm³, whereas endpoint tumors were defined by a total tumor burden of 1.7 cm³. To determine the size of the tumor, the longest diameter of the tumor was used to calculate a spherical volume (V = ¾πr³). All mouse experiments were conducted following Animal Care and Veterinary Services guidelines and standards at the University of Ottawa.

Single-cell RNA-seq of five TNBC tumors was originally performed by Wu et al. [38]. Raw UMI counts and cell metadata were acquired from ENA accession PRJEB35405. The data were processed with Seurat v4.0.0 [39]. Normalization and feature selection were performed using SCTransform [40] while regressing out the proportion of mitochondrial reads. Normalized data were then processed with principal component analysis prior to generating UMAP embeddings based on the first 30 PCs. We then partitioned the cells using Louvain-based clustering on the first 30 PCs using the FindNeighbors(dims = 1:30) and FindClusters(resolution = 0.2) functions implemented in Seurat. Cell-type annotations from the original publication were used to define cluster labels for the data. All expression data shown in figures correspond to log-transformed counts per 10,000 UMIs.

Signaling pathway activity inference was performed with PROGENy (v1.11.2) [41], which infers activity based on pre-built models of pathway effects based from collections of perturbation experiments. Scores were calculated based on the normalized expression values for each cell using the progeny function with top = 500 to base scores on the top 500 genes of its models. Activity scores correspond to Z-score transformations, and the figures presented only show values > 0 to only highlight cells with higher-than-average levels of pathway activity.

Tumors from MMTV-NeuNDL mice or Postn −/−:NeuNDL were harvested at endpoint, minced and digested as previously described [42]. Murine breast cancer lines were maintained in DMEM/F12 containing 10% FBS, 1X mammary epithelial growth supplement (MEGS), 1% Penicillin–Streptomycin and 1% L-glutamine. The Postn-null cells were then infected using retroviral vectors encoding Postn (pMSCV-Postn) or the empty control vector (pMSCV) to be used as a re-expression model.

Full-length Postn cDNA was amplified and cloned into the pMSCV retroviral vector. Infectious retroviruses were generated by transient transfections of retroviral vectors, a packaging plasmid (pUMCV; Addgene) and packaging vector (PCMV-VSV-G; Addgene) into 293 T cells (ATCC). Virus-containing medium was collected 24 h later, filtered through a 0.44-µm filter and then used for infection. The Postn gene was re-introduced into Postn −/− NeuNDL cells by infecting with pMSCV-Postn supernatants and 8 µg/ml of polybrene (Sigma). Control cells were infected with the empty pMSCV vector. Infected cells were then selected in 2 µg/ml of Puromycin (Sigma) for 5 days and subsequently maintained using 1 µg/ml of Puromycin. For siRNA transfections, 2 × 10⁵ cells were seeded and transfected with 400 nM of each siRNA in 1 mL of full medium for 24 h. The cells were transferred to MEGS-depleted medium for an additional 24 h and then assessed for Postn and Akt expression: Akt1 siRNA: AACGAUGGCACCUUUAUUGGC; Akt2 siRNA: AAACUCCUCGGCAAGGGCACC; Akt3 siRNA: AAGGAUGAAGUGGCACACACU.

Cells were seeded in full growth medium (10% FBS, 1X MEGS DMEM:F12) for 24 h prior to replacing the medium. Briefly, the cells were washed and the medium was replenished using the components in 10% FBS DMEM:F12 as indicated in figure legends. Cells were treated using 3 ng/ml EGF (Sigma), 0.01 µg/ml IGF1 (Sigma), 0.5 µg/ml hydrocortisone (Sigma), 0.4% v/v BPE (Thermo Fisher Scientific) and TGFβ-1 recombinant protein (Thermo Fisher Scientific). The TGFβR inhibitor SB431542 (SelleckChem) was used at 5 µg/ml, 25 µM of PI3K inhibitor LY294002 (SelleckChem), 10 µM of AKT inhibitor MK-2206 (SelleckChem), 100 nM of FGFR inhibitor BGJ398 (SelleckChem) and 1 µg/ml PKC activator Phorbol 12-myristate 13-acetate (PMA; SelleckChem). The bFGF neutralizing antibody, clone bFM-1 (Millipore), was used at 2.5 µg/ml.

Murine endpoint tumors and human TMA (Biomax BR962) were subjected to 10% formalin fixation and paraffin embedding, and the sections were processed as previously described [43]. Briefly, the sections were subjected to antigen retrieval using 10 mM citrate buffer (pH 6.0) in a pressure cooker. Sections were then quenched in 3% hydrogen peroxide, blocked and incubated overnight using the indicated primary antibody (Table 1) at 4 °C. Following incubation with secondary antibodies (Table 1), color development and detection was obtained using DAB substrate (Vector Laboratories). Counterstain was performed using hematoxylin. Sections were imaged using a Zeiss Axio Scan.Z1 slide scanner and then processed and analyzed using ImageJ. Quantification was done by assessing the amount of positive staining (brown pixels) using the color deconvolution tool (ImageJ) in the epithelial compartment of the tumors. A set threshold of 30% positive pixels was used to identify acquired versus non-acquired Postn expression status.

Cells were seeded, grown and treated on coverslips for the indicated time of the experiment. Cells were then washed in PBS, followed by fixation in 4% PFA for 10 min. Permeabilization was performed using 0.3% Triton-X for 5 min and blocked using 5% donkey serum in PBS for 30 min, followed by a 1-h incubation using the indicated primary antibody (Table 1) diluted in PBS containing 5% donkey serum. Coverslips were then incubated with Alexa Fluor secondary antibody (Table 1) for 1 h. Finally, the coverslips were washed and mounted using DAPI anti-fade (Invitrogen). Quantification of immunofluorescence was performed by manually counting of the total number of cells (DAPI) and the total Postn-positive cells or nuclear-positive cells for SMAD2. The proportion of positive cells was obtained by % = (# positive stain/total DAPI stain) × 100.

Tissues and cells were collected and homogenized in RIPA lysis buffer containing phosphatase and protease inhibitors as previously described [44]. The lysates were incubated at 4 °C with intermittent vortexing or multiple freeze/thaw cycles. The resulting lysates were then centrifuged at 12,000 rpm in a temperature-controlled centrifuge set to 4 °C for 10 min to clear the lysates of debris. Protein concentration were then determined using a Bio-Rad protein assay dye reagent. Equivalent amounts of proteins were incubated at 100 °C for 5 min in SDS sample buffer, followed by SDS-PAGE electrophoresis and transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore). Membrane was then incubated with the indicated primary antibodies (Table 1) diluted in 5% BSA in TBS-T (0.1%). Membranes were then washed in TBS-T, and protein signals were detected following incubation with species-specific HRP-conjugated secondary antibodies (Table 1) and enhanced chemiluminescence reagent (PerkinElmer).

Cell pellets were homogenized in Trizol reagent (Life Technologies), and total RNA was extracted using the manufacturer’s protocol. Total RNA was then subjected to on-column DNase treatment (QIAGEN) followed by first-strand cDNA synthesis using 500 ng of RNA, SuperScript III (Life Technologies), a mix of random primers (Invitrogen) and oligo dT (Invitrogen). Gene-specific primers and SYBR Green Reagent (Bio-Rad) were used to amplify the indicated targets. Reactions was carried out using an Applied Bioscience 7500 Fast-Real-Time PCR system. The forward and reverse primer sequences for Postn are 5′ AAGTTTGTTCGTGGCAGCAC 3′ and 5′ TTCTGTCACCGTTTCGCCTT 3′, respectively.

Transwell haptotaxis migration assays were performed by seeding cells in the top chamber of a collagen-coated Boyden Chamber insert (underside) in low serum conditions (1% FBS) with the same medium in the bottom chamber. Cells were left to migrate for 8 h; membranes were then fixed with 4% PFA and subjected to crystal violet (0.5%) staining. Manual counting was performed to assess the number of cells that successfully migrated through the pores of the membrane.

Postn has been shown to be expressed in the stroma of mammary tumors. However, the epithelial compartment has been found to express Postn in about 60% of cases and this has been correlated with poor prognosis [20]. To assess whether this pattern was also observed in murine tumors, we investigated the proportion of tumors that acquired epithelial expression of Postn in multiple HER2+ breast cancer murine models and compared it to human tissue microarrays (hTMA). Human breast cancer TMAs containing a mix of subtypes (Biomax BR962) and endpoint tumors from MMTV-NeuNDL [34], MMTV-NIC [35] and MMTV-PyMT [36] were subjected to immunohistochemistry using an anti-Postn antibody (Fig. 1A). Following staining, tumors that had more than 30% positive pixels in the epithelial compartments were classified as “acquired” Postn expression. After quantification, tumors and TMA cores were classified into a non-acquired (no/low POSTN epithelial expression) and acquired phenotype (high POSTN epithelial expression). As previously reported, acquired expression was observed in about 45% of human tumor cores, independently of the breast cancer subtype (Fig. 1B). Interestingly, murine tumors from all three HER2+ models showed acquired POSTN expression in approximately 50% of the tumors (Fig. 1B), suggesting that murine tumors acquire POSTN expression at a similar frequency. To further assess the POSTN expression pattern across the various cell types in breast tumors, we analyzed single-cell RNA sequencing data from five human TNBC tumors generated by Wu et al. [38]. Using these data, we assessed POSTN levels across cell types and found that its expression is largely specific to fibroblasts and cancer cell populations (Fig. 1C, D). Comparing its expression between individual tumors, POSTN is consistently expressed in tumor fibroblasts, but is expressed in cancer cells in only two of the five tumors (Fig. 1E), suggesting that stromal Postn expression is regulated differently than in epithelial cells. Combined with previous studies, these results show that Postn expression in the epithelial compartment is acquired in about 40–50% of breast cancers irrespective of subtypes.

To investigate the role of Postn in tumor cell growth and invasion in vitro, we isolated wild-type and Postn-deficient tumor cells from MMTV-NeuNDL and MMTV-NeuNDL × Postn-null animals, respectively. To minimize the effect of cell line variability, Postn was re-expressed in a Postn-deficient line and stable pools were compared. Interestingly, the loss of Postn did not show any differences in growth rate (Additional file 1: Figure S1) or migration (Additional file 2: Figure S2A, B) in vitro. Similar studies using basement membrane extracts also showed no difference in invasive potential (not shown). One possibility is that the effects of Postn on tumor cells are mediated through reorganization of the microenvironment that would not occur in culture. Serendipitously, we observed that prolonged culture or starvation through mammary epithelial growth supplement (MEGS) removal induced Postn expression in cultured tumor cells (Additional file 3: Figure S3A). Interestingly, this induction was also more prominent under low serum conditions (Fig. 2A). A MMTV-NeuNDL isolate showing strong Postn induction at 36 h was selected for the remainder of the studies. To assess Postn expression at the single-cell level, we performed Postn immunofluorescence on cells growing in full medium or MEGS-depleted conditions for 24 h (Fig. 2B). Quantification of Postn expressing cells from representative images showed a significant increase in the proportion of cells expressing Postn in MEGS-depleted medium (Fig. 2C). To assess whether Postn induction was due to increased mRNA levels, we performed Q-PCR analysis on MEGS-depleted cultures. Postn mRNA levels were monitored in MEGS-depleted medium with varying FBS concentrations from 0 to 10%. As shown in Fig. 2D, MEGS depletion resulted in an increase in Postn mRNA that was also suppressed at high serum concentrations. Together, our data show that components in the MEGS and serum can mediate the repressive effect on Postn gene expression. To further investigate the kinetics and mechanisms of MEGS-mediated repression, we performed time course studies following MEGS removal. Western blotting analysis shows that Postn expression is induced 16 h following MEGS removal and reaches maximal levels at about 36 h (Fig. 3A). The MEGS supplement contains a mixture of growth factors (EGF, IFG1, Hydrocortisone, BPE), and repressive ability of each individual component was assessed at 24 h. Western blot analysis shows that, within the MEGS, only the bovine pituitary extract (BPE) demonstrates strong repressive ability (Fig. 3B). Similarly, Q-PCR analysis shows that the BPE is necessary and sufficient to inhibit Postn mRNA induction (Fig. 3C). Additional analyses showed that the repressive component(s) responsible for Postn repression found in BPE are heat labile (Additional file 3: Figure S3B) and that they are acting in a dose-dependent manner (Additional file 3: Figure S3C). Albeit with different kinetics, the induction of Postn following MEGS depletion was also observed in different isolates from MMTV-NeuNDL and MMTV-NIC tumors, suggesting that it is not cell line specific (Additional file 4: Figure S4A, B). These data suggest that one or more components of the BPE confer the repressive activity on Postn gene expression.

Several studies have implicated hormones and growth factors in the regulation of Postn expression [45]. Based on these findings, we tested the repressive ability of potential pituitary hormones such as prolactin, luteinizing hormone and follicle-stimulating hormone. None of the hormones tested, including cAMP analogs, showed any effect on Postn gene expression (not shown). Interestingly, Postn has been shown to be induced by TGFβ and bFGF [8, 19], both produced by the pituitary [46, 47]. Therefore, we tested their effect on Postn expression upon MEGS removal. Western blotting analysis confirmed the induction of Postn in these cells following a 24-h TGFβ-1 treatment (Fig. 4A). Treatment with the TGFβR inhibitor SB431542 on MEGS-depleted cultures prevented Postn induction (Fig. 4B). The decrease in phospho-SMAD2 levels confirmed the activity of the inhibitor (Fig. 4B).

We next assessed the effect of bFGF on Postn expression. Cultures were treated with bFGF in the presence or absence of MEGS. Surprisingly, bFGF treatment in the MEGS-depleted cultures repressed Postn induction (Additional file 5: Figure S5). This was partially reversed upon treatment with the pan-FGFR inhibitor (BGJ398; Additional file 5: Figure S5), suggesting that bFGF-mediated Postn repression proceeds through FGFR signaling. Further supporting the role of bFGF in BPE-mediated repression, treatment of the cultures with BPE that has been pre-incubated with an anti-bFGF neutralizing antibody is able to partially restore Postn induction (Fig. 4C). Additionally, cells treated with TGFβ-1 in combination with bFGF showed a repression of Postn, suggesting that FGFR signaling activates a repressive cross talk to the TGFβ pathway in this context (Additional file 6: Figure S6). Supporting the presence of FGF2 in BPE, a protein-based, thermolabile and growth-promoting “Fibroblast Growth Factor” (FGF2) activity was also identified in extracts from bovine pituitary glands decades ago [48‐51].

To test whether the activation of Postn following MEGS removal proceeded through TGFβ canonical signaling (SMAD-dependent), we assessed nuclear localization of SMAD2 protein as a readout for SMAD complex activation. Although it induces Postn, MEGS removal did not alter SMAD2 nuclear import (Fig. 4D and Additional file 7: Figure S7). Similarly, bFGF treatment did not affect SMAD2 distribution. These results suggest that MEGS-mediated repression of Postn expression occurs through a bFGF-dependent mechanism and that Postn induction through MEGS removal is SMAD-independent.

Both the TGFβR and FGFR pathways signal to multiple systems (reviewed in [52, 53]). To further dissect the mechanisms of Postn gene regulation, we treated the cultures with several inhibitors in the presence or absence of MEGS. Combined with MEGS removal, treatment of the cells with inhibitors for p38 (SB203580) or MEK1 (U0126) did not affect Postn expression, suggesting that their downstream signals do not mediate induction or repression (not shown). Similarly, MEGS removal did not affect phospho-c-Jun levels, suggesting that JNK activity is not critical for Postn upregulation (not shown). We then assessed the role of the PI3K pathway, activated by both TGFβ and FGFR and an important pro-tumorigenic signal in breast cancer. Treatment of MEGS-depleted cultures with the PI3K inhibitor LY294004 or the pan-Akt inhibitor MK-2206 resulted in a decrease in pAkt-S473 levels by 24 h and a complete block of Postn induction (Fig. 5A, B). However, bFGF treatment in the presence of the same inhibitors had no effect on the repressive ability of bFGF (Fig. 5A, B). Furthermore, western blotting analysis of cells subjected to TGFβ-1 treatment in combination with MK-2206 did not induce Postn expression (Fig. 5C). Similarly, bFGF neutralizing antibody treatment in the absence of MEGS resulted in Postn repression in the presence of MK-2206 (Fig. 5D). As for MK-2206, knockdown of Akt1 markedly reduced Postn induction following MEGS removal (Additional file 8: Figure S8). Interestingly, Akt2 or Akt3 knockdowns had no effect (not shown). Supporting a role for FGFR downstream signaling in Postn repression, treatment with the protein kinase C (PKC) activator PMA was as efficient as bFGF alone in preventing Postn induction, suggesting that PKC plays a role in Postn repression (Additional file 9: Figure S9). Together, these data suggest that Postn induction requires the PI3K/Akt pathway that can be repressed by bFGF signaling, partly through PKC (Fig. 6).