Skip to main content
Erschienen in: Molecular Cancer 1/2010

Open Access 01.12.2010 | Research

Role of microRNA-199a-5p and discoidin domain receptor 1 in human hepatocellular carcinoma invasion

verfasst von: Qingli Shen, Vito R Cicinnati, Xiaoyong Zhang, Speranta Iacob, Frank Weber, Georgios C Sotiropoulos, Arnold Radtke, Mengji Lu, Andreas Paul, Guido Gerken, Susanne Beckebaum

Erschienen in: Molecular Cancer | Ausgabe 1/2010

Abstract

Background

Micro-ribonucleic acid (miRNA)-199a-5p has been reported to be decreased in hepatocellular carcinoma (HCC) compared to normal tissue. Discoidin domain receptor-1 (DDR1) tyrosine kinase, involved in cell invasion-related signaling pathway, was predicted to be a potential target of miR-199a-5p by the use of miRNA target prediction algorithms. The aim of this study was to investigate the role of miR-199a-5p and DDR1 in HCC invasion.

Methods

Mature miR-199a-5p and DDR1 expression were evaluated in tumor and adjacent non-tumor liver tissues from 23 patients with HCC undergoing liver resection and five hepatoma cell lines by the use of real-time quantitative RT-PCR (qRT-PCR) analysis. The effect of aberrant miR-199a-5p expression on cell invasion was assessed in vitro using HepG2 and SNU-182 hepatoma cell lines. Luciferase reporter assay was employed to validate DDR1 as a putative miR-199a-5p target gene. Regulation of DDR1 expression by miR-199a-5p was assessed by the use qRT-PCR and western blotting analysis.

Results

A significant down-regulation of miR-199a-5p was observed in 65.2% of HCC tissues and in four of five cell lines. In contrast, DDR1 expression was significantly increased in 52.2% of HCC samples and in two of five cell lines. Increased DDR1 expression in HCC was associated with advanced tumor stage. DDR1 was shown to be a direct target of miR-199a-5p by luciferase reporter assay. Transfection of miR-199a-5p inhibited invasion of HepG2 but not SNU-182 hepatoma cells.

Conclusions

Decreased expression of miR-199a-5p contributes to increased cell invasion by functional deregulation of DDR1 activity in HCC. However, the effect of miR-199a-5p on DDR1 varies among individuals and hepatoma cell lines. These findings may have significant translational relevance for development of new targeted therapies as well as prognostic prediction for patients with HCC.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1476-4598-9-227) contains supplementary material, which is available to authorized users.
Qingli Shen, Vito R Cicinnati contributed equally to this work.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

QS, VRC and SB designed, performed, and analyzed the research and wrote the paper. XZ and ML performed additional substantial experiments and critically reviewed the manuscript. SI performed statistical analysis. FW, GCS and AR participated in patient sample collection and data analysis; GG and AP conceived the study, participated in its design and helped to draft the manuscript. All authors read and approved the final manuscript.
Abkürzungen
AJCC/UICC
American Joint Committee on Cancer and International Union Against Cancer
AUROC
area under receiver operating characteristics
β-gal
beta-galactosidase
CI
confidence interval
DDR1
discoidin domain receptor-1
GAPDH
glyceraldehyde-3-phosphate dehydrogenase
HCC
hepatocellular carcinoma
HMBS
hydroxymethyl-bilane synthase
HPRT1
hypoxanthine phosphoribosyl-transferase 1
MGB
minor grove binder
miRNA
micro-ribonucleic acid
miR-199a-5p
microRNA excised from the 5' arm of microRNA-199a precursor
NT
non-tumor tissue
qRT-PCR
quantitative real-time reverse transcription polymerase chain reaction
RIN
RNA integrity number
RNU44
small nucleolar RNA C/D box 44
SD
standard deviation
SDHA
succinate dehydrogenase complex, subunit A
SE
standard error
siRNA
short interfering RNA
UTR
untranslated region
WST
water soluble tetrazolium.

Introduction

Hepatocellular carcinoma (HCC) is the fifth most common malignancy worldwide and has an increasing incidence in western countries [1]. Although the risk factors for HCC are well characterized, the molecular pathogenesis of this particular tumor type is not well understood [2]. Micro-ribonucleic acids (miRNAs) represent an abundant class of endogenous small RNA molecules of 20-25 nucleotides in length [3] capable of mediating a vast gene regulatory network [4]. MiRNAs can regulate gene expression by direct cleavage of targeted messenger-RNAs (mRNAs) or by inhibiting translation through complementarity to targeted mRNAs at the 3'untranslated regions (UTRs) [5]. Computational analysis indicates that the total number of miRNAs may be greater than 1% of the protein coding genes in the human genome [6]. To date, 721 human miRNAs are annotated in the miRBase release 14.0 database [7]. Genes targeted by miRNAs control multiple biological processes in health and disease [8], including cancer development [9]. Accumulating evidence suggests that some miRNAs may function as oncogenes or tumor suppressors [10]. Recently, miRNA expression patterns have been investigated in HCC [1116]. Although decreased expression of miR-199a-5p has been frequently demonstrated in HCC [11, 12, 15], functional analysis and translational relevance of this phenomenon has not been defined. The discoidin domain receptor (DDR) belongs to a novel class of receptor tyrosine kinases with a characteristic discoidin homology domain, stalk region, transmembrane region, juxtamembrane region, and kinase domain [17]. The DDR family consists of two members, DDR1 and DDR2, which can be alternatively spliced into five DDR1 isoforms (DDR1a-e) [18]. Over-expression of DDR1 was detected in several human cancers including breast [19], ovary [20], and lung [21]. The precise mechanism(s) by which these receptors may contribute to oncogenesis are not yet known. Targeted deletion of DDR1 in mice results in severe defects in placental implantation and mammary gland development [22], suggesting a potential role in cell migration and extracellular matrix degradation. Over-expression of DDR1 has been shown to increase the migration and invasion of hepatoma cells in vitro[23], implicating a causal role of DDR1 in promoting tumor progression. DDR1 is predicted to be a potential target of miR-199a-5p using publicly available PicTar (4-way), TargetScanS, and miRanda algorithms [24]. Thus, we postulated that aberrantly expressed miR-199a-5p may contribute to invasion by modulation of DDR1 expression in HCC patients.

Methods

Patients, tissues, cell lines, and cultures

HCC tissues and adjacent non-tumor tissues (NTs) used for qRT-PCR were collected from 23 HCC patients who underwent liver resection between December 2000 and March 2007 at the University Hospital Essen (Essen, Germany). Tissues were snap frozen in liquid nitrogen immediately after resection and then stored at -80°C until use. Demographic patient data are presented in Table 1. Tumor staging was performed according to the American Joint Committee on Cancer and International Union Against Cancer (AJCC/UICC) staging system (6th edition, 2002). Histological tumor grading was performed according to the Edmondson-Steiner classification: grade 1-2 (well differentiated), grade 3 (moderately differentiated), and grade 4 (poorly differentiated). The study was approved by the local ethics committee and all patients provided written informed consent. Hepatoma cell lines Hep3B (HB-8064), HepG2 (HB-8065), SK-HEP-1 (HTB-52) and SNU-182 (CRL-2235) were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured as recommended by the supplier. HuH-7 was a kind gift from Dr. Brigitte Pützer (Department of Vectorology and Experimental Gene Therapy, Biomedical Research Center, University of Rostock, Rostock, Germany). Primary human hepatocytes were obtained from ScienCell (San Diego, CA, USA).
Table 1
Demographic data of patients (n = 23)
Variable
Value ± SD1 (%)
Age (years)
63.6 ± 15.5
Gender (male)
16 (69.5)
Underlying liver disease
16 (69.5)
Alcoholic liver disease
2 (8.7)
Cryptogenic cirrhosis
3 (13.1)
Hepatitis B
3 (13.1)
Hepatitis C
3 (13.1)
Nonalcoholic fatty liver disease
5 (21.6)
Multiple tumoral nodules
10 (43.5)
Tumor size - diameter of the biggest nodule (cm)
8.6 ± 4.3
Tumor grade 2
 
Well-differentiated (G1-2)
2 (8.7)
Moderately-differentiated (G3)
14 (60.9)
Poorly-differentiated (G4)
7 (30.4)
UICC/AJCC 3
 
I
3 (13.1)
II
6 (26.1)
III
13 (56.5)
IV
1 (4.3)
1Standard deviation
2Edmondson-Steiner
3International Union Against Cancer (UICC)/American Joint Committee on Cancer (AJCC) tumor-node-metastasis (TNM) staging system (6th version, 2002)

Generation of firefly luciferase constructs

Standard molecular biology techniques were used for generation of all constructs. For generation of a reporter vector bearing a human DDR1 fragment with putative miR-199a-5p binding sites, target sequences were cloned in the pMIR-REPORT Luciferase vector (Ambion). The pMIR-REPORT™ miRNA Expression Reporter Vector System consists of an experimental vector with a firefly luciferase reporter gene under the control of a cytomegalovirus promoter/termination system and an associated beta-galactosidase (β-gal) reporter gene control plasmid. The 3'UTR of the luciferase gene contains a multiple cloning site for insertion of predicted miRNA binding targets. By cloning a predicted miRNA target sequence into pMIR-REPORT, the luciferase reporter is subjected to regulation that mimics the miRNA target. The pMIR-REPORT β-gal reporter plasmid is used for transfection normalization. A human DDR1 3'UTR 457-bp fragment bearing all 4 putative binding sites for miR-199a-5p, which are identical among all the DDR1 splice variants, was generated by RT-PCR from total RNA extracted from HepG2 cells. Primers (Spe I and Hind III restriction sites are underlined) used to amplify this fragment were 5'-ACTAGT TTCCTTCCTAGAAGCCCCTGT-3' (forward primer) and 5'-AAGCTT CCCCAAT CCCAATATTTACTCC-3' (reverse primer) (Eurofins MWG Operon, Ebersberg, Germany). The PCR product was purified on agarose gel, isolated and first inserted into the pGEM-T easy vector (Promega) following the manufacturer's instructions. The pGEM-T plasmids were digested with the appropriate restriction enzymes and electrophoresed in agarose gel. The isolated insert was then excised from the gel, purified and subsequently subcloned in the Hin dIII/Spe I site of the pMIR-REPORT Luciferase vector. Plasmid constructs were verified for correctness by DNA sequencing using ABI PRISM® 3130 Genetic Analyzer (Applied Biosystems).

Transfections

Pre-miR™ miRNA precursors of miR-199a-5p and non-targeting control miRNA precursors (Pre-miR™ miRNA Precursor Molecules-Negative Control #1) were purchased from Ambion, Inc. (Austin, TX, USA). Short interfering RNA (siRNA) against DDR1 mRNA (DDR1-siRNA) and a negative control siRNA were obtained from Qiagen (Hilden, Germany). Transfections of miRNA, siRNA as well as cotransfections of miRNA precursors and reporter vectors were performed using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, CA, USA). Conditions for HepG2 and SNU-182 cells were optimized to yield transfection efficiencies of 78% and 67%, respectively, with a cell viability > 80%. GAPDH knockdown and cell viability were both assessed by the KDalert™glyceraldehyde-3-phosphate dehydrogenase (GAPDH) assay kit (Ambion) for small RNA transfection.

qRT-PCR

Total RNA from tissues and cells was prepared using the miRNeasy Mini Kit (Qiagen). The integrity and quantity of extracted RNA were assessed using Agilent RNA 6000 Nano Chip kit (Agilent Technologies, Waldbronn, Germany) with an Agilent 2100 Bioanalyzer (Agilent Technologies). Samples with RNA integrity number (RIN) values higher than 5 or higher than 8 were considered to have good and perfect total RNA quality, respectively, for downstream qRT-PCR application [25]. Therefore, RNA samples with RIN values lower than 5 were excluded from this study. Total RNA was treated with TURBO DNA-free™ kit (Ambion) to remove any contaminating DNA from the RNA preparations. TaqMan® qRT-PCR assays (Applied Biosystems, Darmstadt, Germany) were performed for qRT-PCR analysis to determine the quantity of mature miRNA. The primer and probe design for miRNA was done according to Chen et al. [26]. A multiplex reverse transcription reaction was carried out using 50 ng of total RNA and the TaqMan® MicroRNA Reverse Transcription Kit as described by Tang et al. [27]. PCR was performed using TaqMan® Universal PCR Master Mix without AmpErase® uracil N-glycosylase according to the manufacturer's instructions. PCR efficiency of each set of primers and probes for each run was determined by a series of 2-fold cDNA dilutions of total RNA from primary human hepatocytes. DDR1 mRNA expression was determined by qRT-PCR assay using the SYBR® Green QuantiTect RT-PCR Kit (Qiagen). Again, a series of 2-fold RNA dilutions was performed to determine PCR efficiency. All samples were run in triplicate on 96-well reaction plates with the iQ5 multicolor real-time PCR detection system (Bio-Rad, Hercules, CA, USA). Data were rescaled using qBase (version 1.3.5) [28], and the optimal reference genes were determined using geNorm (version 3.5) [29]. One sample was used as an inter-run calibration control to compare quantities between plates. Expression of mature miR-199a-5p was normalized with expression of small nucleolar RNA C/D box 44 (RNU44) and hydroxymethyl-bilane synthase (HMBS). Expression of DDR1 mRNA was normalized with optimal reference genes as previously described [30]. The sequences of primers and probes are shown in Table 2.
Table 2
Primers and probes for miR-199a-5p, DDR1 and reference genes.
Gene
Primer
Sequence (5'→3')
miR-199a-5p
RT
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGAACAGGT
 
Forward
ACACTCCAGCTGGGCCCAGTGTTCAGACTAC
 
Reverse
CTCAACTGGTGTCGTGGAGTCGGCAA
 
Probe
(6-FAM) TTCAGTTGAGGAACAGGT (MGB*)
RNU44
Forward
CCTGGATGATGATAGCAAATGC
 
Reverse
GGCAATTCAGTTGAGAGTCAGTTAGA
 
Probe
(6-FAM) ACTGAACATGAAGGTCTT (MGB*)
HMBS
(TaqMan assay)
Forward
ATGTCTGGTAACGGCAATGC
 
Reverse
GTACCCACGCGAATCACTCT
 
Probe
(6-FAM) CTGCAACGGCGGAAGAAAACAGC
DDR1
Forward
AATCGCAGACTTTGGCATGAG
 
Reverse
CGTGAACTTCCCCATGAGGAT
GAPDH
Forward
TGCACCACCAACTGCTTAGC
 
Reverse
GGCATGGACTGTGGTCATGAG
HMBS
(SYBR Green assay)
Forward
TGCAACGGCGGAAGAAAA
 
Reverse
ACGAGGCTTTCAATGTTGCC
HPRT1
Forward
TGACACTGGCAAAACAATGCA
 
Reverse
GGTCCTTTTCACCAGCAAGCT
SDHA
Forward
TGGGAACAAGAGGGCATCTG
 
Reverse
CCACCACTGCATCAAATTCATG
*MGB: minor grove binder with non fluorescent quencher; miR-199a-5p: microRNA excised from the 5' arm of microRNA-199a precursor; RNU44: small nucleolar RNA, C/D box 44; HMBS: hydroxymethyl-bilane synthase; DDR1: discoidin domain receptor-1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; HPRT1: hypoxanthine phosphoribosyl-transferase 1; SDHA: succinate dehydrogenase complex, subunit A.

Actinomycin D treatment for determination of mRNA stability

HepG2 cells were plated in 24-well plates and transfected with 10 nM of miR-199a-5p, miR-control or 100 nM si-DDR1 as a positive control. After transfection for 6 hours, cells were incubated with or without 4 μg/ml of actinomycin D (Sigma-Aldrich, Chemie GmbH, Steinheim, Germany) for additional 36 hours. Total RNA was extracted from cells and DDR1 mRNA was quantified by qRT-PCR described above. The expression levels of DDR1 are presented as values normalized against 106 copies of β-actin transcripts.

Luciferase reporter assay

The pMIR-DDR1-3'-untranslated region (UTR) luciferase vector, containing the putative binding site for miR-199a-5p in the multiple cloning site within the 3' UTR of the luciferase gene in the pMIR-REPORT™ miRNA Expression Reporter Vector (Ambion) was constructed according to the manufacturer's instructions. HepG2 cells were plated at 2 × 105 cells/well in triplicate in 12-well plates. The pMIR-DDR1-3'-UTR construct (200 ng) together with β-gal expression vector pMIR-REPORT β-gal (200 ng) (Ambion) was cotransfected with Pre-miR™ miRNA Precursor Molecules or negative control miRNA precursors (Ambion). Luciferase assays and β-gal enzyme assays were performed 24 hours after transfection according to the manufacturer's protocol (Promega Corporation, Madison, WI, USA). Firefly luciferase activity was normalized to β-gal expression for each sample.

Matrigel matrix invasion assay

Cell invasion assays were conducted using BD BioCoat Matrigel Invasion chambers (BD Biosciences Clontech, Heidelberg, Germany). Briefly, 48 hours after transfection 4 × 104 HepG2 cells or 2 × 104 SNU-182 cells were seeded into the top chamber with a Matrigel coated filter and 750 μl Dulbecco's Modified Eagle Medium containing 5% fetal bovine serum was used as a chemoattractant. Simultaneously, 100 μl of the cell suspension was seeded into 96-well plate in five replicates for cell number normalization using WST-1 assay. Inserts were incubated at 37°C with 5% CO2 for 22 hours. After incubation, cells that were still on the upper side of the filters were mechanically removed. Cells that migrated to the lower side were fixed with 100% methanol and stained with 1% toluidine blue (Sigma-Aldrich) in 1% borax (Sigma-Aldrich). Cells were counted in five fields for triplicate membranes at 10× magnification using an inverted optical microscope (Nikon ECLIPSE TS100, Nikon, Japan). The WST-1 assay was also performed and the invasion index was normalized to cell numbers.

Cell proliferation assay

Cell proliferation was assessed using the water-soluble tetrazolium-1 (WST-1) assay following the manufacturer's protocol (Roche Applied Science). Cells were plated at the density of 8,000/well in 96-well plates (BD Biosciences, Rockville, MD), transfected as described above, and incubated at 37 °C. Cell proliferation was assessed after 72 hours in 5 replicates.

Western blotting

Transfected cells were washed once with ice-cold PBS and lyzed in 1 × blue loading buffer (Cell Signaling Technology, Danvers, MA, USA) supplemented with a protease inhibitor cocktail (Roche Diagnostics). Protein samples were subjected to 10% of SDS-PAGE and blotted with primary antibody selectively recognizing DDR1 (C-20, Santa Cruz Biotechnology). To determine the amounts of loaded proteins, blots were probed with GAPDH (Cell Signaling Technology). Protein bands were visualized using ECL Plus Western blotting detection reagents (Amersham Biosciences, Buckinghamshire, UK) after incubation with appropriate HPR-conjugated secondary antibodies (Jackson Immuno Research Laboratories, West Grove, PA, USA), followed by exposure to Kodak Bio-Max films (Carestream Health, Paris, France).

Statistical analysis

Data are expressed as mean ± SD unless otherwise indicated. Categorical data are described as frequency of the subjects with a specific characteristic. Chi-square test or Fisher's exact test was used for comparing categorical data and Student's t-test, Mann-Whitney-U-test, one-way ANOVA or Kruskal-Wallis test, when appropriate, was used for comparing continuous variables. Spearman's rank test correlation coefficient was used to measure the degree of association between two quantitative variables. Agreement of quantitative variables was evaluated by the correlation coefficient (r). To identify potential predictors of AJCC/UICC stage III-IV, univariate and multivariate analyses were performed. A forward stepwise selection method was used to select variables for the multivariate regression model. Two-tailed p-values less than 0.05 were considered statistically significant. Statistical analysis was performed using SPSS software version 12.0 (SPSS Inc., Chicago, IL, USA).

Results

Patient demographic data

A total of 23 patients were enrolled in the study and their characteristics are shown in Table 1. The mean age of the patients was 63.6 ± 15.5 years and 69.6% were male. There was no difference between cirrhotic and non-cirrhotic patients regarding number and size of tumors, AJCC/UICC stage, recurrence, or intrahepatic metastasis.

Decreased miR-199a-5p expression in human HCC tissues and cell lines

Matched tumoral and non-tumoral tissues of 12 patients were also included in another study, in which global miRNA profiling using miRNA microarray was performed (data not shown). MiR-199a-5p expression data acquired by real time RT-PCR correlated well with microarray data (r = 0.8077, p < 0.001), indicating that the qRT-PCR results are reliable. A significant down-regulation of miR-199a-5p (mean 0.15, SE 0.05, 95% CI 0.04-0.25, range 0.00-0.61) was noted in 15 of 23 (65.2%) HCC tissues compared to NTs (mean 1.24, SE 0.13, 95% CI 0.96-1.53, range 0.65-2.22, p < 0.0001, Figure 1A). No correlation between miR-199a-5p expression and clinical parameters was encountered. We next compared miR-199a-5p expression between hepatoma cell lines and primary human hepatocytes. Similarly to results obtained from HCC tissues, expression of miR-199a-5p was significantly (p < 0.001) decreased in four HCC cell lines (Hep3B, HepG2, HuH-7, and SK-HEP-1). However, increased expression of miR-199a-5p was found in another hepatoma cell line, SNU-182, compared with primary human hepatocytes (Figure 2A).

Expression of DDR1 in human HCC tissues and cell lines

DDR1 was found to be significantly (p < 0.001) upregulated in HCC tissues (mean 8.49, SE 2.03, 95% CI 4.02-12.95, range 2.45-23.36) compared to matched NTs (mean 2.3, SE 0.58, 95% CI 1.02-3.57, range 0.74-8.15) in 12 of 23 (52.2%) patients (Figure 1B). Similarly, in two out of five hepatoma cell lines, HepG2 and SNU-182, DDR1 expression was significantly (p < 0.001) upregulated compared to primary human hepatocytes (Figure 2B). DDR1 expression was correlated significantly with both AJCC/UICC stage (r = 0.45, p = 0.03) and tumor status (r = 0.42, p = 0.04) in patients. Relative DDR1 expression values of AJCC/UICC stage III-IV patients (mean 7.11, SE 1.91, 95% CI 2.97-11.24, range 0.18-26.36) were significantly higher than those of AJCC/UICC stage I-II patients (mean 2.19, SE 0.64, 95% CI 0.71-3.67, range 0.25-5.65, p = 0.01) (Figure 3). Analyzing predictive factors for advanced tumor stage at diagnosis of HCC (Table 3), we found a significant association between AJCC/UICC stage III-IV and the following variables: histological grade of HCC (poorly differentiated) (p = 0.01), presence of macrovascular invasion (p = 0.04), and increased expression of DDR1 compared to NTs (p = 0.01). Multivariate logistic regression analysis performed for the variables that were significant (p < 0.05) in the univariate analysis, indicated that high DDR1 expression was the only single independent factor associated with HCC at AJCC/UICC stage III-IV (p = 0.04). There was no correlation between the expression of DDR1 and miR-199a-5p in tissues (r = 0.36, p = 0.09).
Table 3
Results of univariate analysis for factors associated with advanced HCC stage at diagnosis
Variable
AJCC/UICC stage I-II
AJCC/UICC stage III-IV
p value
Male gender
66.7%
71.4%
0.80
Age (years)
69.4 ± 8.0
60 ± 18.1
0.20
Multiple tumor nodules
44.4%
42.9%
0.94
Diameter of the biggest nodule (cm)
6.7 ± 4.4
9.8 ± 4.0
0.10
Viral infection
22.2%
28.6%
0.73
Cirrhosis
44.4%
28.6%
0.43
Poorly differentiated HCC (G4)
0%
50%
0.01
Macrovascular invasion
22.2%
64.3%
0.04
Mir-199a expression (median value)
0.07
0.36
0.17
DDR1 expression (median value)
1.54
5.05
0.01

MiR-199a-5p differentially regulates the expression of DDR1 in HepG2 and SNU-182 cells

DDR1 mRNA is predicted to be a potential target of miR-199a-5p using PicTar (4-way), TargetScanS, and miRanda algorithm (Table 4) [24]. To assess whether miR-199a-5p can directly alter the expression of DDR1 luciferase reporter assays were employed. A fragment of the 3'-UTR of DDR1 mRNA, containing the putative miR-199a-5p-binding sequence, was cloned into a firefly luciferase reporter construct and co-transfected with a control β-gal reporter construct into HepG2 cells together with miR-199a-5p-specific precursor or control. A significant (p < 0.001) decrease in relative luciferase activity was observed when miR-199a-5p precursor was cotransfected with the luciferase reporter construct containing the fragment of the 3'-UTR of DDR1 mRNA. In contrast, no change in relative luciferase activity was observed in cells transfected with pMIR-REPORT™ firefly luciferase reporter control vector without the insert consisting of the 3'-UTR of DDR1 mRNA fragment (Figure 4A). These results indicate that miR-199a-5p can modulate gene expression directly via the DDR1 3'-UTR. In agreement with these data, qRT-PCR and western blotting shows that enhanced expression of miR-199a-5p as well as knockdown of DDR1 by siRNA result in a significant decrease of endogenous DDR1 mRNA and protein levels in HepG2 cells (Figures 4B and 5A). In mRNA stability assays we established that mir-199a-5p-mediated regulation of DDR1 in HepG2 cells is mainly achieved by degradation of DDR1 mRNA (Figure 5C). In contrast, transfection of miR-199a precursor in another hepatoma cell line, namely SNU-182, was not associated with an alteration of DDR1 mRNA expression (Figure 4C). However, a notable decrease of DDR1 protein levels became evident after miR-199a-5p precursor transfection (Figure 5B).
Table 4
DDR1 mRNA is predicted to be a potential target of miR-199a-5p by TargetScanS
 
predicted consequential pairing of target region (top)
and miRNA (bottom)
Position 1165-1185 of DDR1 3' UTR
5' ...AGAAAUAUAGGAUAGACACUGGA...
 
                                       | | | | | | |
hsa-miR-199a-5p
3'    CUUGUCCAUCAGACUUGUGACCC
Position 1199-1219 of DDR1 3' UTR
5' ...GGAGCACCUGGGCCCCACUGGAC...
 
                                         | | | | | |
hsa-miR-199a-5p
3'  CUUGUCCAUCAGACUUGUGACCC
Position 1260-1280 of DDR1 3' UTR
5' ...CUCUCUCCCUGUCACACACUGGA...
 
                                        | | | | | | |
hsa-miR-199a-5p
3'    CUUGUCCAUCAGACUUGUGACCC
Position 1383-1403 of DDR1 3' UTR
5' ...CCUCCAUCACCUGAAACACUGGA...
 
                                        | | | | | | |
hsa-miR-199a-5p
3'    CUUGUCCAUCAGACUUGUGACCC

MiR-199a-5p differentially modulates invasion of hepatoma cell lines in vitro

We assessed the role of miR-199a-5p in tumor invasion by the ability of hepatoma cells to cross an extracellular matrix, a key determinant of malignant progression and metastasis formation. HepG2 cells were transfected with 10 nM miR-199a-5p precursor or 100 nM DDR1-siRNA, and invasive potential was assessed after 48 hours. Expression of miR-199a-5p precursors (p = 0.004) and DDR1-siRNA (p = 0.003) significantly decreased invasion of the HepG2 cell line (Figure 6A). These results suggest that altered expression of miR-199a-5p in HepG2 cells may contribute to increased cell invasiveness by functional deregulation of the activity of DDR1. However, only transfection of DDR1-siRNA (p = 0.002) but not of miR-199a-5p precursors (p = 0.820) significantly decreased invasion of another hepatoma cell line, namely SNU-182 (Figure 6A).

MiR-199a-5p does not modulate proliferation of HepG2 and SNU-182 cells in vitro

To characterize the effect of miR-199a-5p on hepatoma proliferation, we performed overexpression studies using the miR-199a-5p specific precursor. Proliferation of HepG2 and SNU-182 cells was neither altered by precursor miR-199a-5p (p = 0.486 and p = 0.073, respectively) nor by DDR1-siRNA (p = 0.980 and p = 0.141, respectively) (Figure 6B). These studies indicate that DDR1 is rather involved in the process of tumor cell invasion than in tumor growth.

Discussion

Decreased miR-199a-5p expression in HCC has been repeatedly reported, but its functional relevance has not been elucidated to date [11, 12, 15]. A pivotal role for miRNAs in the process of malignant transformation has been suggested in the literature [9, 31]. However, the precise molecular mechanisms by which miRNAs modulate tumor cell biology are largely unknown. MiRNAs from animals were first reported to repress translation without affecting mRNA levels [32]. More recent evidence indicated that miRNAs and siRNAs can control post-transcriptional gene expression by directing the endonuclease cleavage of target mRNA, which is referred to as "slicer" activity [33]. Endonucleolytic cleavage is generally favored by perfect base-pairing between miRNA and mRNA. Some mismatches, however, can be tolerated and still allow endonucleolytic cleavage to occur [34]. The majority of animal miRNAs are only partially complementary to their targets [35]. Several reports have shown that animal miRNAs can also induce significant degradation of target mRNAs despite imperfect mRNA-miRNA base-pairing [36, 37], referred to as "slicer"-independent decay. This phenomenon emphasizes mRNA degradation as an important aspect of miRNA-mediated repression of gene expression. There is also some evidence that "slicer"-independent mRNA decay induced by miRNAs might occur through promotion of mRNA decapping and 5'-3'-degradation [33]. The contribution of translational repression or mRNA degradation to gene silencing appears to differ for each miRNA:target pair and is likely to depend on the particular set of proteins bound to the 3'UTR of the mRNA [38]. MiR-199a-5p, which is partially complementary to the 3' UTR of DDR1 mRNA, induced significant degradation of DDR1 mRNA in hepatoma cells in our study. Thus, DDR1 has been experimentally validated as a target gene of miR-199a-5p. MiR-199b-5p, which has a very similar nucleotide sequence, is also predicted to target DDR1. However, miR-199b-5p was only detectable in four out of 24 tissue samples in a miRNA microarray assay (data not shown) and it has never been reported to be de-regulated in HCC in literature. Therefore, the regulatory function of miR-199b-5p was not further assessed in this study.
DDR1 is a tyrosine kinase receptor for collagen [22] and its activation can cause tumor invasion which appears to be mediated by matrix metalloproteinases (MMP)2 and MMP9 [19, 23]. Indeed, we found a positive correlation between the expression of DDR1 and MMP2 in our patient cohort (data not shown), further supporting the important role of DDR1 for tumor invasion. Consistent with recently published findings [23] and our results indicating a critical role for DDR1 in HCC progression, we found a significant correlation between the expression of DDR1 and AJCC/UICC tumor stage. Analyzing predictive factors for advanced tumor stage at the time of HCC diagnosis, we found a positive correlation between AJCC/UICC stage III-IV and poor tumor differentiation, presence of macrovascular invasion, and high DDR1 expression. In addition, multivariate logistic regression analysis identified high DDR1 expression as the single independent factor associated with advanced tumor stage, and, hence, poor prognosis. In line with this clinicopathological observation, we found that DDR1 gene silencing by transfection of miR-199a-5p into HepG2 cells significantly decreased tumor cell invasion in vitro. However, our studies also indicate that DDR1 is rather involved in the process of tumor invasion than in tumor growth. These results demonstrated that miR-199a-5p is capable to modulate tumor cell invasion at least in part by targeting DDR1. Although in our study DDR1 has been validated as a target gene of miR-199a-5p, no significant correlation between miR-199a-5p and DDR1 mRNA expression was found in tumor samples from our patient cohort. In addition, SNU-182 hepatoma cells exhibited increased levels of expression of both miR-199a-5p and DDR1 mRNA. Transfection of miR-199a-5p did not induce a change in DDR1 mRNA expression, but significantly down-regulated DDR1 protein in SNU-182 cells. However, no significant inhibitory effect on tumor invasion was noted. Considering the preexisting high expression of miR-199a-5p in SNU-182 cells, our results might hint at a certain independence of DDR1 to miR-199a-5p-mediated gene regulation and function in these cells. Our data hint at a more complex regulation network between DDR1 and miR-199a-5p in HCC. One reason might be that HCC is a very heterogeneous tumor entity and distinct cellular components might interfere with the effect of miR-199a-5p on DDR1 [39]. For instance, by the use of miRNA target prediction algorithms other 23 miRNAs were also predicted to target DDR1 [24]. In addition, DDR1 has been demonstrated to be a direct transcriptional target of the p53 tumor suppressor gene [40] and, therefore, the p53 status in tumor cells may also affect the expression of DDR1. Finally, recent findings reveal a more diverse role for small RNA molecules in the regulation of gene expression than previously recognized. For instance, miRNAs can act also as translation activators under specific cellular conditions [41]. In addition, double strand RNAs can activate rather than repress gene expression by targeting non-coding regulatory regions in gene promoters [42]. To date, the only reported stimulatory effect of miRNA on RNA expression is represented by the interaction between miR-122 and replication of hepatitis C virus RNA in hepatocytes [43]. MiR-199a-5p expression has also been shown to be diversely deregulated in other cancer types. For instance, miR-199a-5p was also found to be down-regulated in ovarian cancer [44] and oral squamous cell carcinoma [45], but up-regulated in cervical carcinoma [46] and bronchial squamous cell carcinoma [47]. Moreover, increased expression of miR-199a-5p has been considered a signature for high metastatic risk and a poor prognosis in uveal melanoma [48].
Thus, the complexity of the regulation of mRNA by miRNA encountered in our and other studies indicates that the effect of miRNA on its target gene is cell type and environment dependent. However, our study demonstrates a previously uncharacterized biological function of miR-199a-5p such as the ability to inhibit tumor invasion through targeting DDR1.
Less than half of patients with HCC are eligible for potential curative treatment including liver resection and transplantation because of advanced tumor stage at time of diagnosis. The combination of clinical and biological predictors may increase diagnostic accuracy of tumor staging, thus permitting optimized therapeutic management of HCC patients. Although DDR1 expression was shown to be the only predictive factor for advanced HCC, our study was clearly limited by the small sample size which may tend to overestimate the prognostic value of DDR1 expression. Thus, prospective studies that seek and independently validate the prognostic utility of DDR1 expression for patients with HCC in a larger and carefully selected cohort should be conducted. Patient survival after surgical treatment is hampered by frequent tumor recurrence and systemic chemotherapy is largely ineffective [49]. In recent years, kinase inhibitors have become an attractive target class for drug development [50], and it was shown recently that systemic application of a multikinase inhibitor improves survival of patients with HCC [51]. Further investigation of therapeutic strategies targeting the miR-199a-5p-DDR1 signaling network is therefore warranted. In conclusion, identification of the miR-199a-5p:DDR1 target pair and its crucial role in tumor cell invasion highlight the translational relevance for both prognostic prediction and targeted molecular therapy for patients with HCC.

Acknowledgements

The authors thank Dr. Brigitte Pützer for kindly providing the HuH-7 cell line and critical reading the manuscript, Dr. Guido Marquitan and Dr. Ruth Broering for helpful suggestions, and Anne Achterfeld for technical assistance. This study was funded in part by 107-05710/IFORES program (V.R.C.) and 107-05470/IFORES program (S.B.) of the University of Essen.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

QS, VRC and SB designed, performed, and analyzed the research and wrote the paper. XZ and ML performed additional substantial experiments and critically reviewed the manuscript. SI performed statistical analysis. FW, GCS and AR participated in patient sample collection and data analysis; GG and AP conceived the study, participated in its design and helped to draft the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Parkin DM, Bray F, Ferlay J, Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 2005, 55: 74-108. 10.3322/canjclin.55.2.74CrossRefPubMed Parkin DM, Bray F, Ferlay J, Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 2005, 55: 74-108. 10.3322/canjclin.55.2.74CrossRefPubMed
2.
Zurück zum Zitat Thorgeirsson SS, Grisham JW: Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet. 2002, 31: 339-346. 10.1038/ng0802-339CrossRefPubMed Thorgeirsson SS, Grisham JW: Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet. 2002, 31: 339-346. 10.1038/ng0802-339CrossRefPubMed
3.
Zurück zum Zitat Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004, 116: 281-297. 10.1016/S0092-8674(04)00045-5CrossRefPubMed Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004, 116: 281-297. 10.1016/S0092-8674(04)00045-5CrossRefPubMed
4.
Zurück zum Zitat Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005, 120: 15-20. 10.1016/j.cell.2004.12.035CrossRefPubMed Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 2005, 120: 15-20. 10.1016/j.cell.2004.12.035CrossRefPubMed
5.
Zurück zum Zitat Lai EC: Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet. 2002, 30: 363-364. 10.1038/ng865CrossRefPubMed Lai EC: Micro RNAs are complementary to 3' UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet. 2002, 30: 363-364. 10.1038/ng865CrossRefPubMed
6.
Zurück zum Zitat Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP: Vertebrate microRNA genes. Science. 2003, 299: 1540- 10.1126/science.1080372CrossRefPubMed Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP: Vertebrate microRNA genes. Science. 2003, 299: 1540- 10.1126/science.1080372CrossRefPubMed
8.
Zurück zum Zitat Singh SK, Pal BM, Girschick HJ, Bhadra U: MicroRNAs--micro in size but macro in function. FEBS J. 2008, 275: 4929-4944. 10.1111/j.1742-4658.2008.06624.xCrossRefPubMed Singh SK, Pal BM, Girschick HJ, Bhadra U: MicroRNAs--micro in size but macro in function. FEBS J. 2008, 275: 4929-4944. 10.1111/j.1742-4658.2008.06624.xCrossRefPubMed
9.
Zurück zum Zitat Meltzer PS: Cancer genomics: small RNAs with big impacts. Nature. 2005, 435: 745-746. 10.1038/435745aCrossRefPubMed Meltzer PS: Cancer genomics: small RNAs with big impacts. Nature. 2005, 435: 745-746. 10.1038/435745aCrossRefPubMed
10.
Zurück zum Zitat Zhang B, Pan X, Cobb GP, Anderson TA: microRNAs as oncogenes and tumor suppressors. Dev Biol. 2007, 302: 1-12. 10.1016/j.ydbio.2006.08.028CrossRefPubMed Zhang B, Pan X, Cobb GP, Anderson TA: microRNAs as oncogenes and tumor suppressors. Dev Biol. 2007, 302: 1-12. 10.1016/j.ydbio.2006.08.028CrossRefPubMed
11.
Zurück zum Zitat Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, Okanoue T: Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006, 25: 2537-2545. 10.1038/sj.onc.1209283CrossRefPubMed Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, Okanoue T: Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006, 25: 2537-2545. 10.1038/sj.onc.1209283CrossRefPubMed
12.
Zurück zum Zitat Jiang J, Gusev Y, Aderca I, Mettler TA, Nagorney DM, Brackett DJ: Association of MicroRNA expression in hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival. Clin Cancer Res. 2008, 14: 419-427. 10.1158/1078-0432.CCR-07-0523PubMedCentralCrossRefPubMed Jiang J, Gusev Y, Aderca I, Mettler TA, Nagorney DM, Brackett DJ: Association of MicroRNA expression in hepatocellular carcinomas with hepatitis infection, cirrhosis, and patient survival. Clin Cancer Res. 2008, 14: 419-427. 10.1158/1078-0432.CCR-07-0523PubMedCentralCrossRefPubMed
13.
Zurück zum Zitat Varnholt H, Drebber U, Schulze F, Wedemeyer I, Schirmacher P, Dienes HP: MicroRNA gene expression profile of hepatitis C virus-associated hepatocellular carcinoma. Hepatology. 2008, 47: 1223-1232. 10.1002/hep.22158CrossRefPubMed Varnholt H, Drebber U, Schulze F, Wedemeyer I, Schirmacher P, Dienes HP: MicroRNA gene expression profile of hepatitis C virus-associated hepatocellular carcinoma. Hepatology. 2008, 47: 1223-1232. 10.1002/hep.22158CrossRefPubMed
14.
Zurück zum Zitat Wang Y, Lee AT, Ma JZ, Wang J, Ren J, Yang Y: Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target. J Biol Chem. 2008, 283: 13205-13215. 10.1074/jbc.M707629200CrossRefPubMed Wang Y, Lee AT, Ma JZ, Wang J, Ren J, Yang Y: Profiling microRNA expression in hepatocellular carcinoma reveals microRNA-224 up-regulation and apoptosis inhibitor-5 as a microRNA-224-specific target. J Biol Chem. 2008, 283: 13205-13215. 10.1074/jbc.M707629200CrossRefPubMed
15.
Zurück zum Zitat Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T: MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 2007, 133: 647-658. 10.1053/j.gastro.2007.05.022PubMedCentralCrossRefPubMed Meng F, Henson R, Wehbe-Janek H, Ghoshal K, Jacob ST, Patel T: MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 2007, 133: 647-658. 10.1053/j.gastro.2007.05.022PubMedCentralCrossRefPubMed
16.
Zurück zum Zitat Budhu A, Jia HL, Forgues M, Liu CG, Goldstein D, Lam A: Identification of metastasis-related microRNAs in hepatocellular carcinoma. Hepatology. 2008, 47: 897-907. 10.1002/hep.22160CrossRefPubMed Budhu A, Jia HL, Forgues M, Liu CG, Goldstein D, Lam A: Identification of metastasis-related microRNAs in hepatocellular carcinoma. Hepatology. 2008, 47: 897-907. 10.1002/hep.22160CrossRefPubMed
17.
Zurück zum Zitat Alves F, Vogel W, Mossie K, Millauer B, Hofler H, Ullrich A: Distinct structural characteristics of discoidin I subfamily receptor tyrosine kinases and complementary expression in human cancer. Oncogene. 1995, 10: 609-618.PubMed Alves F, Vogel W, Mossie K, Millauer B, Hofler H, Ullrich A: Distinct structural characteristics of discoidin I subfamily receptor tyrosine kinases and complementary expression in human cancer. Oncogene. 1995, 10: 609-618.PubMed
18.
Zurück zum Zitat Vogel W: Discoidin domain receptors: structural relations and functional implications. FASEB J. 1999, 13 (Suppl): S77-S82.PubMed Vogel W: Discoidin domain receptors: structural relations and functional implications. FASEB J. 1999, 13 (Suppl): S77-S82.PubMed
19.
Zurück zum Zitat Johnson JD, Edman JC, Rutter WJ: A receptor tyrosine kinase found in breast carcinoma cells has an extracellular discoidin I-like domain. Proc Natl Acad Sci USA. 1993, 90: 5677-5681. 10.1073/pnas.90.12.5677PubMedCentralCrossRefPubMed Johnson JD, Edman JC, Rutter WJ: A receptor tyrosine kinase found in breast carcinoma cells has an extracellular discoidin I-like domain. Proc Natl Acad Sci USA. 1993, 90: 5677-5681. 10.1073/pnas.90.12.5677PubMedCentralCrossRefPubMed
20.
Zurück zum Zitat Laval S, Butler R, Shelling AN, Hanby AM, Poulsom R, Ganesan TS: Isolation and characterization of an epithelial-specific receptor tyrosine kinase from an ovarian cancer cell line. Cell Growth Differ. 1994, 5: 1173-1183.PubMed Laval S, Butler R, Shelling AN, Hanby AM, Poulsom R, Ganesan TS: Isolation and characterization of an epithelial-specific receptor tyrosine kinase from an ovarian cancer cell line. Cell Growth Differ. 1994, 5: 1173-1183.PubMed
21.
Zurück zum Zitat Ford CE, Lau SK, Zhu CQ, Andersson T, Tsao MS, Vogel WF: Expression and mutation analysis of the discoidin domain receptors 1 and 2 in non-small cell lung carcinoma. Br J Cancer. 2007, 96: 808-814. 10.1038/sj.bjc.6603614PubMedCentralCrossRefPubMed Ford CE, Lau SK, Zhu CQ, Andersson T, Tsao MS, Vogel WF: Expression and mutation analysis of the discoidin domain receptors 1 and 2 in non-small cell lung carcinoma. Br J Cancer. 2007, 96: 808-814. 10.1038/sj.bjc.6603614PubMedCentralCrossRefPubMed
22.
Zurück zum Zitat Vogel WF, Aszodi A, Alves F, Pawson T: Discoidin domain receptor 1 tyrosine kinase has an essential role in mammary gland development. Mol Cell Biol. 2001, 21: 2906-2917. 10.1128/MCB.21.8.2906-2917.2001PubMedCentralCrossRefPubMed Vogel WF, Aszodi A, Alves F, Pawson T: Discoidin domain receptor 1 tyrosine kinase has an essential role in mammary gland development. Mol Cell Biol. 2001, 21: 2906-2917. 10.1128/MCB.21.8.2906-2917.2001PubMedCentralCrossRefPubMed
23.
Zurück zum Zitat Park HS, Kim KR, Lee HJ, Choi HN, Kim DK, Kim BT: Overexpression of discoidin domain receptor 1 increases the migration and invasion of hepatocellular carcinoma cells in association with matrix metalloproteinase. Oncol Rep. 2007, 18: 1435-1441.PubMed Park HS, Kim KR, Lee HJ, Choi HN, Kim DK, Kim BT: Overexpression of discoidin domain receptor 1 increases the migration and invasion of hepatocellular carcinoma cells in association with matrix metalloproteinase. Oncol Rep. 2007, 18: 1435-1441.PubMed
24.
Zurück zum Zitat Megraw M, Sethupathy P, Corda B, Hatzigeorgiou AG: miRGen: a database for the study of animal microRNA genomic organization and function. Nucleic Acids Res. 2007, 35: D149-D155. 10.1093/nar/gkl904PubMedCentralCrossRefPubMed Megraw M, Sethupathy P, Corda B, Hatzigeorgiou AG: miRGen: a database for the study of animal microRNA genomic organization and function. Nucleic Acids Res. 2007, 35: D149-D155. 10.1093/nar/gkl904PubMedCentralCrossRefPubMed
25.
Zurück zum Zitat Fleige S, Pfaffl MW: RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med. 2006, 27: 126-139. 10.1016/j.mam.2005.12.003CrossRefPubMed Fleige S, Pfaffl MW: RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med. 2006, 27: 126-139. 10.1016/j.mam.2005.12.003CrossRefPubMed
26.
Zurück zum Zitat Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT: Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005, 33: e179- 10.1093/nar/gni178PubMedCentralCrossRefPubMed Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT: Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005, 33: e179- 10.1093/nar/gni178PubMedCentralCrossRefPubMed
27.
Zurück zum Zitat Tang F, Hajkova P, Barton SC, Lao K, Surani MA: MicroRNA expression profiling of single whole embryonic stem cells. Nucleic Acids Res. 2006, 34: e9- 10.1093/nar/gnj009PubMedCentralCrossRefPubMed Tang F, Hajkova P, Barton SC, Lao K, Surani MA: MicroRNA expression profiling of single whole embryonic stem cells. Nucleic Acids Res. 2006, 34: e9- 10.1093/nar/gnj009PubMedCentralCrossRefPubMed
28.
Zurück zum Zitat Hellemans J, Mortier G, De PA, Speleman F, Vandesompele J: qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8: R19- 10.1186/gb-2007-8-2-r19PubMedCentralCrossRefPubMed Hellemans J, Mortier G, De PA, Speleman F, Vandesompele J: qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8: R19- 10.1186/gb-2007-8-2-r19PubMedCentralCrossRefPubMed
29.
Zurück zum Zitat Vandesompele J, De PK, Pattyn F, Poppe B, Van RN, De PA: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3: R34-10.1186/gb-2002-3-7-research0034.CrossRef Vandesompele J, De PK, Pattyn F, Poppe B, Van RN, De PA: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3: R34-10.1186/gb-2002-3-7-research0034.CrossRef
30.
Zurück zum Zitat Cicinnati VR, Shen Q, Sotiropoulos GC, Radtke A, Gerken G, Beckebaum S: Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR. BMC Cancer. 2008, 8: 350- 10.1186/1471-2407-8-350PubMedCentralCrossRefPubMed Cicinnati VR, Shen Q, Sotiropoulos GC, Radtke A, Gerken G, Beckebaum S: Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR. BMC Cancer. 2008, 8: 350- 10.1186/1471-2407-8-350PubMedCentralCrossRefPubMed
31.
Zurück zum Zitat Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F: A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA. 2006, 103: 2257-2261. 10.1073/pnas.0510565103PubMedCentralCrossRefPubMed Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F: A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA. 2006, 103: 2257-2261. 10.1073/pnas.0510565103PubMedCentralCrossRefPubMed
32.
Zurück zum Zitat Wightman B, Ha I, Ruvkun G: Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993, 75: 855-862. 10.1016/0092-8674(93)90530-4CrossRefPubMed Wightman B, Ha I, Ruvkun G: Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993, 75: 855-862. 10.1016/0092-8674(93)90530-4CrossRefPubMed
33.
Zurück zum Zitat Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R: Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 2006, 20: 515-524. 10.1101/gad.1399806CrossRefPubMed Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R: Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 2006, 20: 515-524. 10.1101/gad.1399806CrossRefPubMed
34.
Zurück zum Zitat Yekta S, Shih IH, Bartel DP: MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004, 304: 594-596. 10.1126/science.1097434CrossRefPubMed Yekta S, Shih IH, Bartel DP: MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004, 304: 594-596. 10.1126/science.1097434CrossRefPubMed
35.
Zurück zum Zitat Filipowicz W: RNAi: the nuts and bolts of the RISC machine. Cell. 2005, 122: 17-20. 10.1016/j.cell.2005.06.023CrossRefPubMed Filipowicz W: RNAi: the nuts and bolts of the RISC machine. Cell. 2005, 122: 17-20. 10.1016/j.cell.2005.06.023CrossRefPubMed
36.
Zurück zum Zitat Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R: Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell. 2005, 122: 553-563. 10.1016/j.cell.2005.07.031CrossRefPubMed Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R: Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell. 2005, 122: 553-563. 10.1016/j.cell.2005.07.031CrossRefPubMed
37.
Zurück zum Zitat Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005, 433: 769-773. 10.1038/nature03315CrossRefPubMed Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J: Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Nature. 2005, 433: 769-773. 10.1038/nature03315CrossRefPubMed
38.
Zurück zum Zitat Behm-Ansmant I, Rehwinkel J, Izaurralde E: MicroRNAs silence gene expression by repressing protein expression and/or by promoting mRNA decay. Cold Spring Harb Symp Quant Biol. 2006, 71: 523-530. 10.1101/sqb.2006.71.013CrossRefPubMed Behm-Ansmant I, Rehwinkel J, Izaurralde E: MicroRNAs silence gene expression by repressing protein expression and/or by promoting mRNA decay. Cold Spring Harb Symp Quant Biol. 2006, 71: 523-530. 10.1101/sqb.2006.71.013CrossRefPubMed
39.
Zurück zum Zitat Roessler S, Budhu A, Wang XW: Future of molecular profiling of human hepatocellular carcinoma. Future Oncol. 2007, 3: 429-439. 10.2217/14796694.3.4.429CrossRefPubMed Roessler S, Budhu A, Wang XW: Future of molecular profiling of human hepatocellular carcinoma. Future Oncol. 2007, 3: 429-439. 10.2217/14796694.3.4.429CrossRefPubMed
40.
Zurück zum Zitat Ongusaha PP, Kim JI, Fang L, Wong TW, Yancopoulos GD, Aaronson SA: p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 2003, 22: 1289-1301. 10.1093/emboj/cdg129PubMedCentralCrossRefPubMed Ongusaha PP, Kim JI, Fang L, Wong TW, Yancopoulos GD, Aaronson SA: p53 induction and activation of DDR1 kinase counteract p53-mediated apoptosis and influence p53 regulation through a positive feedback loop. EMBO J. 2003, 22: 1289-1301. 10.1093/emboj/cdg129PubMedCentralCrossRefPubMed
41.
Zurück zum Zitat Vasudevan S, Tong Y, Steitz JA: Switching from repression to activation: microRNAs can up-regulate translation. Science. 2007, 318: 1931-1934. 10.1126/science.1149460CrossRefPubMed Vasudevan S, Tong Y, Steitz JA: Switching from repression to activation: microRNAs can up-regulate translation. Science. 2007, 318: 1931-1934. 10.1126/science.1149460CrossRefPubMed
42.
Zurück zum Zitat Li LC, Okino ST, Zhao H, Pookot D, Place RF, Urakami S: Small dsRNAs induce transcriptional activation in human cells. Proc Natl Acad Sci USA. 2006, 103: 17337-17342. 10.1073/pnas.0607015103PubMedCentralCrossRefPubMed Li LC, Okino ST, Zhao H, Pookot D, Place RF, Urakami S: Small dsRNAs induce transcriptional activation in human cells. Proc Natl Acad Sci USA. 2006, 103: 17337-17342. 10.1073/pnas.0607015103PubMedCentralCrossRefPubMed
43.
Zurück zum Zitat Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005, 309: 1577-1581. 10.1126/science.1113329CrossRefPubMed Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P: Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science. 2005, 309: 1577-1581. 10.1126/science.1113329CrossRefPubMed
44.
Zurück zum Zitat Iorio MV, Visone R, Di LG, Donati V, Petrocca F, Casalini P: MicroRNA signatures in human ovarian cancer. Cancer Res. 2007, 67: 8699-8707. 10.1158/0008-5472.CAN-07-1936CrossRefPubMed Iorio MV, Visone R, Di LG, Donati V, Petrocca F, Casalini P: MicroRNA signatures in human ovarian cancer. Cancer Res. 2007, 67: 8699-8707. 10.1158/0008-5472.CAN-07-1936CrossRefPubMed
45.
Zurück zum Zitat Yu T, Wang XY, Gong RG, Li A, Yang S, Cao YT: The expression profile of microRNAs in a model of 7, 12-dimethyl-benz[a]anthrance-induced oral carcinogenesis in Syrian hamster. J Exp Clin Cancer Res. 2009, 28: 64- 10.1186/1756-9966-28-64PubMedCentralCrossRefPubMed Yu T, Wang XY, Gong RG, Li A, Yang S, Cao YT: The expression profile of microRNAs in a model of 7, 12-dimethyl-benz[a]anthrance-induced oral carcinogenesis in Syrian hamster. J Exp Clin Cancer Res. 2009, 28: 64- 10.1186/1756-9966-28-64PubMedCentralCrossRefPubMed
46.
Zurück zum Zitat Lee JW, Choi CH, Choi JJ, Park YA, Kim SJ, Hwang SY: Altered MicroRNA expression in cervical carcinomas. Clin Cancer Res. 2008, 14: 2535-2542. 10.1158/1078-0432.CCR-07-1231CrossRefPubMed Lee JW, Choi CH, Choi JJ, Park YA, Kim SJ, Hwang SY: Altered MicroRNA expression in cervical carcinomas. Clin Cancer Res. 2008, 14: 2535-2542. 10.1158/1078-0432.CCR-07-1231CrossRefPubMed
47.
Zurück zum Zitat Mascaux C, Laes JF, Anthoine G, Haller A, Ninane V, Burny A: Evolution of microRNA expression during human bronchial squamous carcinogenesis. Eur Respir J. 2009, 33: 352-359. 10.1183/09031936.00084108CrossRefPubMed Mascaux C, Laes JF, Anthoine G, Haller A, Ninane V, Burny A: Evolution of microRNA expression during human bronchial squamous carcinogenesis. Eur Respir J. 2009, 33: 352-359. 10.1183/09031936.00084108CrossRefPubMed
48.
Zurück zum Zitat Worley LA, Long MD, Onken MD, Harbour JW: Micro-RNAs associated with metastasis in uveal melanoma identified by multiplexed microarray profiling. Melanoma Res. 2008, 18: 184-190. 10.1097/CMR.0b013e3282feeac6CrossRefPubMed Worley LA, Long MD, Onken MD, Harbour JW: Micro-RNAs associated with metastasis in uveal melanoma identified by multiplexed microarray profiling. Melanoma Res. 2008, 18: 184-190. 10.1097/CMR.0b013e3282feeac6CrossRefPubMed
49.
Zurück zum Zitat El-Serag HB, Marrero JA, Rudolph L, Reddy KR: Diagnosis and treatment of hepatocellular carcinoma. Gastroenterology. 2008, 134: 1752-1763. 10.1053/j.gastro.2008.02.090CrossRefPubMed El-Serag HB, Marrero JA, Rudolph L, Reddy KR: Diagnosis and treatment of hepatocellular carcinoma. Gastroenterology. 2008, 134: 1752-1763. 10.1053/j.gastro.2008.02.090CrossRefPubMed
50.
Zurück zum Zitat Luo J, Solimini NL, Elledge SJ: Principles of cancer therapy: oncogene and non-oncogene addiction. Cell. 2009, 136: 823-837. 10.1016/j.cell.2009.02.024PubMedCentralCrossRefPubMed Luo J, Solimini NL, Elledge SJ: Principles of cancer therapy: oncogene and non-oncogene addiction. Cell. 2009, 136: 823-837. 10.1016/j.cell.2009.02.024PubMedCentralCrossRefPubMed
51.
Zurück zum Zitat Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF: Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 2008, 359: 378-390. 10.1056/NEJMoa0708857CrossRefPubMed Llovet JM, Ricci S, Mazzaferro V, Hilgard P, Gane E, Blanc JF: Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 2008, 359: 378-390. 10.1056/NEJMoa0708857CrossRefPubMed
Metadaten
Titel
Role of microRNA-199a-5p and discoidin domain receptor 1 in human hepatocellular carcinoma invasion
verfasst von
Qingli Shen
Vito R Cicinnati
Xiaoyong Zhang
Speranta Iacob
Frank Weber
Georgios C Sotiropoulos
Arnold Radtke
Mengji Lu
Andreas Paul
Guido Gerken
Susanne Beckebaum
Publikationsdatum
01.12.2010
Verlag
BioMed Central
Erschienen in
Molecular Cancer / Ausgabe 1/2010
Elektronische ISSN: 1476-4598
DOI
https://doi.org/10.1186/1476-4598-9-227

Weitere Artikel der Ausgabe 1/2010

Molecular Cancer 1/2010 Zur Ausgabe

Darf man die Behandlung eines Neonazis ablehnen?

08.05.2024 Gesellschaft Nachrichten

In einer Leseranfrage in der Zeitschrift Journal of the American Academy of Dermatology möchte ein anonymer Dermatologe bzw. eine anonyme Dermatologin wissen, ob er oder sie einen Patienten behandeln muss, der eine rassistische Tätowierung trägt.

Erhöhte Mortalität bei postpartalem Brustkrebs

07.05.2024 Mammakarzinom Nachrichten

Auch für Trägerinnen von BRCA-Varianten gilt: Erkranken sie fünf bis zehn Jahre nach der letzten Schwangerschaft an Brustkrebs, ist das Sterberisiko besonders hoch.

Hypertherme Chemotherapie bietet Chance auf Blasenerhalt

07.05.2024 Harnblasenkarzinom Nachrichten

Eine hypertherme intravesikale Chemotherapie mit Mitomycin kann für Patienten mit hochriskantem nicht muskelinvasivem Blasenkrebs eine Alternative zur radikalen Zystektomie darstellen. Kölner Urologen berichten über ihre Erfahrungen.

Ein Drittel der jungen Ärztinnen und Ärzte erwägt abzuwandern

07.05.2024 Klinik aktuell Nachrichten

Extreme Arbeitsverdichtung und kaum Supervision: Dr. Andrea Martini, Sprecherin des Bündnisses Junge Ärztinnen und Ärzte (BJÄ) über den Frust des ärztlichen Nachwuchses und die Vorteile des Rucksack-Modells.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.