Background
Head and neck squamous cell carcinoma (HNSCC) is the sixth common cancer worldwide with more than 350,000 cancer-related deaths per year. Multiple etiological factors have been identified to critically contribute to this malignancy including smoking abuse, alcohol consumption, betel quid chew and human papillomavirus (HPV) infection [
1]. Even though combined and multidisciplinary therapy against HNSCC have been established, the long-term survival rate of HNSCC patients has not been markedly improved in the past decades [
2]. Major prognostic factors include invasive depth, cervical lymph node metastasis and advanced TNM stage [
3]. Much efforts have been made to unveil the cellular and molecular mechanisms of HNSCC tumorigenesis [
4]. However, the precise mechanisms under its initiation and development still remain fragmented. Thus, identification of new biomarkers and therapeutic targets for HNSCC is urgently needed for clinicians to improve the patients’ prognosis.
The Hippo signaling pathway has increasingly been recognized as a key and indispensable mediator in tissue homeostasis, organ size control, metabolism, regeneration and tumorigenesis [
5]. Defects in Hippo signaling and hyperactivation of its downstream effectors yes-associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ) essentially contribute to cancer initiation, outgrowth, metastatic dissemination and therapeutic resistance [
6,
7]. Pervasively activated YAP and TAZ in human malignancies accumulated in the nucleus where they drive gene transcription mainly by forming complexes with TEA domain DNA-binding family of transcription factors (TEADs) [
8]. In mammal, there are four TEAD protein members, namely TEAD1–4. TEADs are broadly expressed but each member has tissue-specific expression pattern which suggests tissue-specific roles for each TEAD [
9]. Previous studies have revealed important functions of TEAD members in various biological processed and human diseases [
10,
11]. TEAD transcription factors are not only crucial for developmental process, but also play important roles in tumor initiation and progression [
9,
11,
12]. TEADs promote cell proliferation, migration and invasion, epithelial-mesenchymal transition in several solid tumors including prostate, breast, colorectal and gastric cancers by binding with or without YAP/TAZ [
13‐
15]. Previous reports largely focused on the expression and biological roles of YAP and TAZ during tumorigenesis [
7,
16,
17]. However, the accurate biological functions of TEADs in human cancer are just beginning to disclose in selected contexts and remain yet unexplored in HNSCC.
Here, we sought to determine the expression of TEAD4 and its clinicopathological significance in human HNSCC samples and chemical-induced HNSCC animal model. Moreover, we determined the tumorigenic roles of TEAD4 by functional assays in vitro and revealed the critical links between TEAD4 and EMT in HNSCC.
Materials and methods
Patients and tissue specimens
A total number of 105 patients with primary HNSCC (Jan. 2008 and Dec. 2014.) receiving radical resection of cancer at the Department of oral and maxillofacial surgery, Nanjing Medical University were enrolled. Written informed consent was obtained from these patients. Patient inclusion criteria were described as follows: (1) primary HNSCC with no prior chemotherapy or radiotherapy; (2) patients underwent radical tumor resection and neck lymph node dissection; (3) detailed demographic, clinical, pathological and follow-up data available. The archived tissue samples and haematoxylin–eosin stained sections of each patient were retrieved. The previous histological diagnosis as SCC were further histopathologically conformed according to the established histological criteria. Twenty samples of healthy oral mucosa were obtained from intraoral trauma surgery at the same period. This study protocol was reviewed and approved by the Research Ethic Committee of Nanjing Medical University.
Cell lines and chemicals
A panel of HNSCC cell lines including Cal27, Fadu, SCC4, SCC25, HN4 and HN6 were used. Non-tumorigenic HOK and Cal27, Fadu, SCC4 and SCC25 were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). HN4 and HN6 cell lines were generous gifts from Prof. Wantao Chen from Shanghai Jiaotong University. Cancer cells were grown in DMEN/F12 (Invitrogen) supplemented with 10% FBS (Gibco) and 100 units/ml antibiotics, and maintained at 37 °C. For TGF-β1-induced EMT cell model in vitro, morphological changes and relevant markers expression were monitored in cells which were treated with recombinant human TGF-β1 (rhTGF-β1, 10 ng/ml, R&D Systems) for indicated times.
Small interference RNA (siRNA) DNA constructs and transfection
The siRNA oligonucleotides including TEAD4 siRNA-1 (5′-CCGCCAAAUCUAUGACAAATT′, 5′-UUUGUCAUAGAUUUGGCGGTT′) TEAD4 siRNA-2 (5′-CGCUCUGUGAGUACAUGAUTT-3′, 5′-AUCAUGUACUCACAGAGCGTT′) and control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′, 5′-ACGUGACACGUUCGGAGAATT-3′) were designed and purchased from GenePharma (Shanghai, China). Transfection of siRNA oligonucleotides with final concentration 100 nM was performed with Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s instruction. Then cells were harvested for further experiments 48 h after transfection unless otherwise specified.
The human TEAD4 overexpression construct tagged with single FLAG was generated by inserting the TEAD4 full-length cDNA template into plasmid GV141. Following transient transfection with TEAD4 overexpression plasmid, cells were harvested at 48 h for further experiments. Stable cell clones with TEAD4 overexpression were selected by appropriate antibiotics (G418, 500 ng/ml, Sigma) for 2 weeks after plasmid transfection.
Cell proliferation and viability were assessed by absorbance using CCK-8 cell viability assay (Cell Counting Kit-8, Dojindo, Japan) per manufacturer’s instructions. Cells were seeded in 96-well microplates at a density of 2 × 10
3 cells per well. Cells were incubated in new medium containing 10% CCK-8 reaction solution. After incubation for 2 h, the absorbance was measured on a spectrophotometer microplate reader (Multiskan MK3, Thermo) at a wavelength of 450 nm. Colony formation assay was performed as we previously reported [
18].
Cell apoptosis assessed by flow-cytometric assay
Cells were treated with trypsin (Gbico) and resuspended as single-cell suspension. Cells were stained with Annexin V:PE Apoptosis Detection Kit (BD Bioscience) and submitted to a FACSCalibur flow cytometer (BD Biosciences). Data were analyzed with CellQuest Pro software (BD Biosciences).
In vitro cell invasion and wound healing assay
For wound-healing assays, cells were seeded at a density of 1 × 10
6 cell/well in six-well plates. Then we used a sterile 10 μl pipette tip to create an artificial wound on the confluent cell monolayer. The suspended cells were washed thoroughly with PBS, and cells were cultured in medium with 1% FBS (Gibco). The wounds were photographed at 0, 6, 12 and 24 h as indicated. Cell invasion were determined by a Matrigel transwell invasion assay. In brief, 1 × 10
5 viable cells were suspended in 200 μl of DMEN/F12 (Invitrogen) without serum and seeded into upper chamber precoated with Matrigel (BD Biosciences, USA). Complete medium with 10% serum was added to the lower chamber as chemoattractant. After incubation for 12 h, the non-invading cells were gently removed with a cotton swab, while those invaded cells adherent to the lower side of membrane were stained with a 0.1% crystal violet solution, photographed and counted as our revious reports [
19,
20].
Immunofluorescence assay
For immunofluorescence assays, cells were seeded on glass coverslips 18 h prior to experiment and fixed with 4% paraformaldehyde and washed thoroughly with PBS. After these, the cells were permeabilized in Triton X-100 (0.1% in PBS) for 1 h and washed thoroughly with PBS. Then cells were blocked with 3% bovine serum albumin (BSA) for 30 min at room temperature followed by incubation with primary antibodies against E-cadherin (1:200 dilution) and vimentin (1:150 dilution) overnight, respectively. Cells were further incubated with corresponding secondary antibodies and/or cytoskeleton actin/nuclear staining. Immunofluorescence was visualized under a Zeiss fluorescence microscope or confocal microscope.
RNA extraction and real time RT-PCR
Total RNA was extracted from cells and subjected to reverse transcription and PCR reactions using PrimeScriptTM RT-PCR kit (Takara) as described previously [
19,
20]. Relative mRNA expression was quantified as compared to internal control GAPDH using comparative CT method. The primers were listed as follows: TEAD4 (forward: TCCACGAAGGTCTGCTCTTT, reverse: GTGCTTGAGCTTGTGGATGA) and GAPDH (forward: AGGTGAAGGTCGGAGTCAAC, reverse: AGTTGAGGTCAATGAAGGGG).
Western blot analysis
Cells were harvested and lysed in ice-clod cell lysis buffer containing protease inhibitor cocktail (Invitrogen). The same amount of protein samples were electrophoresed through 10% SDS-PAGE and transferred to PVDF membranes (Bio-Rad). Following 5% non-fat milk or BSA blocking, these membranes were incubated at 4 °C overnight with primary antibodies TEAD4 (1:1000, ab58310, Abcam), E-cadherin (1:2000, #3195, Cell signaling), N-cadherin (1:1000, #13116, Cell signaling), vimentin (1:2000, #5741, Cell signaling), snail (1:1000, #3879, Cell signaling) and GAPDH (1:2000, sc-32233, Santa Cruz) followed by incubation with horseradish peroxidase(HRP)-conjugated secondary antibodies. Immunoreactive bands on the blots were detected by ECL chemiluminescence kit (Bio-Rad).
4-nitroquinoline 1-oxide (4NQO)-induced HNSCC animal model
In the 4NQO-induced HNSCC animal model, squamous cell carcinoma was initiated and progressed in tongue. This experimental was performed as our previous reports with minor modifications [
21‐
23]. In brief, 6-week-old C57BL/6 mice were fed with drinking water containing 50 μg/mL 4NQO for consecutive 16 weeks and then given with normal water for another 8–10 weeks. Animals with normal water was used as controls. Lesions in tongue were visually inspected every week. Samples were harvested at 16, 20 and 24 weeks after chemical administration and subjected to histopathological analyses.
Immunohistochemical staining and scoring
Immunohistochemical staining for TEAD4 was performed on 4 μm-thick slides from formalin-fixed paraffin-embedded samples using routine procedures as our previously reported [
7]. Negative controls without primary TEAD4 antibody (1:200, GTX108750, GeneTex) incubation were included. Immunoreactivity was semi-quantitatively evaluated according to staining intensity and distribution using the immunoreactive score which was calculated as intensity score × proportion score as we reported previously [
20,
24]. Intensity score was defined as 0, negative; 1, weak; 2, moderate; 3, strong, while the proportion score was defined as 0, negative; 1, < 10%; 2, 11–50%; 3, 51–80%; 4, > 80% positive cells. The total score ranged from 0 to 12. Accordingly, the immunoreactivity of each slide was categorized into three subgroups based on the final score: 0, negative; 1–4, low expression; 4–12, high expression as we reported before [
20,
24].
Data mining and analysis of TEAD4 mutation and expression in HNSCC via publicly available database
The original data concerning mutational landscape and mRNA expression of TEAD1–4 in HNSCC were retrieved from 3 publicly available databases including cBioPortal (
http://www.cbioportal.org/) [
25], TCGA (
https://cancergenome.nih.gov/) and Oncomine (
https://www.oncomine.org/) [
26]. TEAD4 mRNA expression levels (log2-transformed) in HNSCC and normal counterparts were retrieved and statistically compared. The associations between expression status of TEAD4 mRNA (high or low using median value as cutoff) and patient survival were determined by Kaplan-Meir analysis.
Statistical analysis
All quantitative data was presented as mean ± SD from two or three independent experiments and compared with Student’s t-test or ANOVA with Bonferroni post hoc test unless otherwise specified. The correlations between TEAD4 expression and various clinicopathological parameters were evaluated by Chi square or Fisher exact test. Patient survival was estimated using Kaplan–Meier method and compared with Log-rank test. The prognostic analyses were performed by univariate and multivariate Cox regression models to determine the individual clinicopathological variables with patient overall survival. P values less than 0.05 (two-sided) were considered statistically significant. All statistical analyses were performed using GraphPad Prism 8 or SPSS 21.0 software.
Discussion
Until now, deregulated Hippo signaling pathway has been demonstrated to be intricately associated with tumorigenesis and serves as viable therapeutic targets with translational potentials [
6]. TEAD4 functions as a key member of Hippo signaling mediating transcriptional output via forming complex with YAP or TAZ. Several lines with evidence have revealed that TEAD4 has oncogenic roles and prognostic significance underlying multiple cancer contexts [
14,
15,
37,
39]. In the present study, we utilized the HNSCC samples, animal model and in vitro cellular assay to delineate the expression pattern, prognostic roles and tumorigenic functions of TEAD4 in HNSCC. Our findings revealed that TEAD4 served as a novel putative oncogene to promote HNSCC tumorigenesis and as a novel prognsotic biomarker for HNSCC.
Previous studies have revealed that TEAD4 is usually amplificated and/or overexpressed in multiple cancers including atypical teratoid/rhabdoid tumor, serous ovarian carcinoma, colorectal cancer, lung adenocarcinoma, gastric cancer and OSCC [
14,
15,
33,
38‐
40]. In line with this, both bioinformatics analyses from multple independent patient cohorts and immunohistochemistry in primary HNSCC samples revealed aberrant overexpression of TEAD4 in a large subset of patients examined. Moreover, results from 4NQO-induced HNSCC model showed that TEAD4 expression increased along with disease initiation and progression from hyperplasia to invasive carcinoma. Although TEAD4 amplification was identified in selected cancers [
33,
38], genetic amplification of TEAD4 was not prominent as evidenced by the fact that less than 2.5% HNSCC samples harbored genetic alternations of TEAD4, thus largely precluding the possibility of genetic amplification of TEAD4 responsible for its overexpression in most HNSCC samples. Together, these findings gave strong support to the idea that TEAD4 as a bona fide oncogene promotes HNSCC tumorigenesis, although the precise molecular mechanisms underlying its overexpression await further elucidation. To the best of our knowledge, this might be the first study to reveal the abnormal overexpression pattern of TEAD4 in HNSCC.
Several previous reports have proposed important clinical relevance of TEAD4 overexpression in human cancer [
14,
15,
39]. For example, elevated TEAD4 expression significantly associated with advanced stage, distant metastasis and poor outcome in colorectal cancer [
14]. Consistantly, our data from primary HNSCC samples revealed that TEAD4 overexpression significantly associated with high pathological grade, cervical node metastasis and advanced clinical stage. Moreover, results from Kaplan–Meier survival and univariate/multivariate Cox-regression analyses showed that TEAD4 overexpression significantly associated with reduced survival and served as an independent prognostic predictor for patients’ survival. However, we failed to reveal positive correlations between TEAD4 mRNA level and clinical grades, pathological stages as well as overall survival from TCGA-HNSCC dataset. We reasoned that it’s conceivable due to prominent heterogeneity of HNSCC and different strategies for patient stratification between TCGA-HNSCC cohort and our cohort. Inconsistency between mRNA and protein expression of TEAD4 might also account for this discrepancy. Of course, larger amount of patients with HNSCC from multiple centers is needed to establish the prognostic significance of TEAD4 and its clinical benefits of TEAD4 as a novel biomarker for patient stratification.
Previous reports have demonstrated that TEAD4 is critically involved in tumorigenesis by promoting cell proliferation, metastasis, EMT and suppressing apoptosis [
14,
15,
37,
40]. For example, impaired cell proliferation and induction of G1 cell cycle arrest were observed in OSCC cell upon TEAD4 knockdown [
40]. TEAD4 silencing markedly attenuated cell migration and invasiveness in lung adenocarcinoma [
41]. In addition, increased nuclear TEAD4 expression promoted EMT and metastasis in colorectal cancer while its knockdown induced mesenchymal-epithelial transition and decreased cell mobility in vitro and metastasis in vivo [
14]. Consistent with these above-mentioned findings, our results indicate that TEAD4 has multiple tumorigenic roles by modulating cell proliferation, apoptosis, migration and invasion in HNSCC cells. Noticeably, our results also indicated that TEAD4 promoted invasion and motility by facilitating EMT in HNSCC as evidenced by morphological alternations and EMT marker changes upon TEAD4 depletion and overexpression, its critical role during TGF-β1-induced EMT as well as positive association between TEAD4 expression and cervical node metastasis. Multiple downstream targets including vimentin and FSCN1 have been identified to mediate EMT induced by TEAD4 in colorectal cancer and gastric cancer [
14,
42]. Moreover, Liu et al. [
43] have reported that TEAD4 and AP1 co-occupy on active enhancer or promoter and drive a core set of downstream targets like CDH2 (encoding N-cadherin) to coordinate cancer cell migration and invasion. However, the downstream targets responsible for TEAD4-induced EMT in HNSCC remains unknown and requires further exploration. In addition, further studies are still needed to unravel the intricate crosstalk between TEAD4 and TGF-β pathway behind EMT and metastasis in HNSCC. Collectively, our findings together with others strongly suggest that TEAD4 probably functions as a putative pro-tumorigenic gene via enhancing cancer cell proliferation, migration and invasion in HNSCC.
Conclusion
In conclusion, our findings revealed the expression pattern, prognostic and tumorigenic roles of TEAD4 and identified TEAD4 as a novel biomarker with diagnostic and prognostic significance in HNSCC and as a putative oncogenic mediator underlying HNSCC initiation and progression. Our findings suggest that selective targeting of TEAD4 by genetic or chemical approach might hold translational promise against HNSCC.
Authors’ contributions
WZ, JL and YW performed the experimental study, data collection and analysis and manuscript writing. WZ, HG and YS carried out the most experiments. DW, HY and HJ performed histological and statistical analyses. JC and YW conceived and supervised the whole project. All authors read and approved the final manuscript.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.