Introduction
Hypoxic-ischemic brain damage (HIBD) is the most common central nervous system diseases in the neonatal period and has a poor prognosis. A large number of children have residual nerve damage, which is manifested as mental developmental delay, intellectual disability, or even death [
1‐
3]. Meanwhile, pediatric vitamin A deficiency (VAD) is a global public health problem. A preclinical investigation found that neonates with HIBD suffered from more severe VAD than those who had pneumonia or those who were healthy, and the vitamin A (VA) levels did not significantly increase with advancing age (Additional file
1: Figure S1). It has previously been found that VA could affect neural development after birth [
4]. Therefore, it was hypothesized that VA can affect neural tissue and functional outcome after HIBD.
The hippocampus is crucial for learning and memory [
5] and is susceptible to HIBD injury [
6]. VA is an important fat-soluble vitamin that carries out physiological functions similar to those of hormones via its main derivative, retinoic acid (RA). The hippocampus and its surrounding meninges synthesize and metabolize RA, promoting the expression of retinol-binding protein (RBP) [
7]. Apoptosis is the important mechanism of pathological damage in the acute stage of HIBD. Therefore, apoptosis in the hippocampus was the target of the present study.
VA plays a pivotal role in a suite of essential biologic processes as a powerful regulator of vision, reproduction, immunity, apoptosis, growth and development. RA is associated with cell proliferation and differentiation, and additionally contributes to the proper development of the vertebrate central nervous system [
8,
9]. RA can modulate the transcription or nontranscription of downstream target genes or functional proteins through retinoic acid receptor (RAR)-mediated signal transduction. RAR heterodimers attach to specific DNA sequences or RA response elements (RAREs), which are typically composed of two direct repeats of a core hexameric motif. RA interacts with two major families of nuclear receptors: retinoic acid receptors (RAR) and retinoid X receptors (RXR). Each family is composed of three isotypes: α, β, and γ. The RARα isoform has an essential role in brain development and modulates adult brain function [
10,
11].
RA can promote carcinoma cell apoptosis, and larger doses of all-trans retinoic acid are currently used for the therapy of certain cancers [
12]. VAD causes apoptosis of pancreatic beta-cell masses [
13]. Paradoxically, RA has been reported to have protective effects against the neuronal apoptosis caused by injury, and it enhances proliferation and survival. These effects all depend on transcriptional signaling that involves RA and anti-apoptosis pathways [
14]. A previous study found that RARα was primarily a nuclear receptor present in the rat cerebral cortex and white matter during postnatal development [
4]. VAD in pregnancy can attenuate the expression of RARα, causing concomitant deficits in active learning and spatial memory function in adolescence [
4,
15]. It has been demonstrated that treatment with appropriate concentrations of RA can influence the mitochondrial membrane potential (MMP) to reduce the apoptosis of oxygen-glucose deprivation (OGD)-injured PC12 cells, possibly through the regulation of RARα signaling [
16,
17]. It is speculated that the bidirectional regulation of apoptosis depends on the concentration of RA and the types of target cells and tissues. Accordingly, it is hypothesized that a suitable concentration of RA will have an anti-apoptotic effect on neurons in HIBD. Numerous studies have been devoted to investigating the mechanism of apoptosis and the pathway to antagonize hippocampal cell apoptosis after hypoxic-ischemic injury. However, these studies on hypoxic-ischemic damage and the potential mechanism of anti-apoptotic effects involved in RA are still inconclusive.
The present study examined the effects of RA on apoptosis produced by hypoxic-ischemic damage in vivo and in vitro. In addition, adenovirus-transfected primary neurons were used to investigate the possible signaling pathway involved in the neuroprotective anti-apoptotic effects of RA.
Methods
Animals
All animal experiments were approved by the Animal Experimentation Ethical Committee of the Zoology Center at Chongqing Medical University (Chongqing, China) and in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978). Sprague Dawley (SD) rats were procured from the Experimental Animal Center of Chongqing Medical University [SCXK (Yu) 2012–0015]. The rats were randomly assigned into four groups: control (sham), VA normal (VAN), VAD and vitamin A supplemented (VAS). Random number was generated with SPSS 17. The Animal Care Committee of Chongqing Medical University approved the experimental protocol.
Diets
The female breeder rats in the VAD and VAN groups were fed with 300 IU and 7000 IU retinol/kg diet per day, respectively, for 4 weeks, then throughout pregnancy, and the pups were nursed from the VAD or VAN mother rats until the end of the experiment [
18]. The VAS rats were VAD rats fed by VAN dams from HIBD P1 until the end of the experiment. The diets were the same except for VA content (Additional file
1: Figure S1).
Hypoxic-ischemic animal model
The hypoxic-ischemic animal model was established using the Rice-Vannucci method [
19]. The ligation of left common carotid artery was performed on 7-day-postnatal rats. One hour after the surgical procedure, the rats were put in a hypoxic tank and received hypoxic treatment (8% oxygen and 92% nitrogen) at a flow rate of 0.5 L/min for 2.5 h. The control group received the same treatment as the other groups except for the ligation and hypoxic treatment.
HPLC testing of serum VA
The serum VA concentrations were estimated using HPLC in accordance with our previously described methods with slight modifications [
20]. Two hundred microliters of serum was dissolved in 200 μL of dehydrated alcohol; 1000 μL of hexane was added and fully mixed, and the solution was centrifuged at 13,200rpm for 8 min. Then, 500 μL of the supernatant was carefully transferred and dried with nitrogen. The residue was dissolved in the mobile phase (methanol: water = 97:3). Finally, an HPLC apparatus (DGU-20As, Shimadzu Corporation, Japan) was then used to detect the prepared sample (C18, 315 nm).
Measurement of apoptosis by TUNEL immunofluorescence staining
Rats from VAN and VAD groups were killed on post-HIBD days 3 and 7. Additionally, serial hippocampal sections were prepared, and the nuclei were stained with Hoechst 33,258 (Beyotime, China). Imaging was performed using an inverted fluorescence microscope system (NikonTE2000-S, Japan). We counted the number of TUNEL-positive cells in corresponding square regions.
Morris water maze test
A Morris water maze test system [
21] (MWM SLY-WMS 2.0, China) was used to evaluate the spatial learning and memory functions of rats, as previously described. Briefly, a visible platform was used to evaluate the rats’ vision on the first training day. Animals were exposed to an invisible platform to raise their ability of learning and memory from the second to the fifth day. In the whole 5 days, the average escape latency and path length in locating the platform were recorded. We conducted a probe trial with no escape platform and recorded the number of times that the rats swam across the former platform location in 60 s on the sixth day.
Shuttle box test
A shuttle box test [
4] (KE KE ZH-DSX2, China) was performed on post-HIBD day 30. The rats were placed in the shuttle box for 1 min to adapt to the environment and then placed in the shock zone for training on the first day. The formal test was conducted from the second to the fifth day. If the rats ran into the safe chamber within 10 s after the sound, the response was recorded as an active avoidance response; if the rats did not run into the safe chamber when given electric shock, the response was recorded as a passive avoidance response; if there was no response, the result was recorded as a no avoidance response.
Isolation and culture of primary neurons
Zero-day-old rat pups were killed and hippocampal neurons were isolated and cultured according to previous procedures with some modifications [
22]. The hippocampus of each rat was removed and digested by treatment with TrypLE (Gibco, USA) at 37°C for 30 min, and then centrifuged at 1000 rpm for 5 min to obtain the precipitate. Finally, the cells were seeded in a 6-well plate with 10% fetal bovine serum (FBS) (Gibco, USA) in DMEM/F12 medium (Gibco, USA). The medium was changed to Neurobasal medium (Gibco, USA) involving 2% B27 supplement (Gibco, USA) and 0. 5 mM L-glutamine (Gibco, USA) the next day.
Oxygen and glucose deprivation
On the day of the experiment, the culture medium was replaced with Earle’s balanced salt solution [
17] (EBSS; HyClone, USA). OGD was induced by placing the neurons in a humidified incubator (Thermo, USA) containing a mixture of 5% oxygen and 95% nitrogen for 1.5 h to simulate ischemic injury.
RA treatment
RA (Sigma, USA) was added to the Neurobasal medium at final concentrations of 0, 1, 5, 10, 20, or 40 μmol/L for 24 h. Next, the neurons that had been treated with each concentration of RA were injured by OGD.
Detection of apoptosis by annexin V-PI staining and flow cytometry
Each well was washed twice with D-Hank’s solution after OGD. The cells were collected and digested with TrypLE for 1 min, and centrifuged at 1000 rpm at 4°C for 5 min. The cells were measured sequentially with a flow cytometer (BD FACSAria, USA).
Measurement of mitochondrial membrane potential by JC-1 staining and flow cytometry
Each well was washed twice with D-Hank’s solution after OGD. The cells were collected and digested with 0.5 mL TrypLE for 1 min, and centrifuged at 1000 rpm at 4°C for 5 min. The cells were measured sequentially using a flow cytometer (BD FACSAria, USA).
Measurement of caspase-3 and caspase-8 protein activity by ELISA
Hippocampal tissue homogenates (20~40 mg) and 100 μL/100 million primary neurons were subjected to lysis on ice for 15 min. The lysates were centrifuged at 12,000 rpm at 4°C for 5 min. The caspase-3 and caspase-8 activity levels were measured at 405 nm using an automatic microplate reader ELx800 (BioTek, USA).
RNA interference of RARα
Recombinant adenoviruses carrying the rat RARα (overRARα) or RNA interference virus RARα-siRNA (siRARα) were used to infect neurons [
18]. The recombinant adenovirus was allowed to infect the neurons for 24 h to test the mRNA levels and 48 h to explore the protein levels. Red fluorescent protein (RFP) was used to label the nonspecific siRNA (siRARγ) and acted as the negative control.
Real-time PCR RARα and other signaling pathway molecules in the hippocampus and primary neurons
Extraction of the hippocampal and primary neuronal RNA was performed using a total RNA isolation system, EZgenoTM (Genemega, USA). The purified mRNA was reverse transcribed into cDNA using the PrimeScript RT Reagent Kit (TaKaRa, Japan). cDNA quantification by real-time PCR was performed using a StepOne v2.1 Real-Time PCR instrument (ABI, USA) and RealMasterMix (SYBR Green; Tiangen Biotech, China). The cycles were performed as follows: denaturation at 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, 60°C for 60 s, and 72°C for 30 s. Data were standardized to the endogenous expression of β-actin.
caspase-8 | Fwd: 5′GGCAGCCAGTTCTTCGTT3′ Rev: 5′CTCGGCGACAGGTTACAG3′ |
caspase-3 | Fwd: 5′GGGTGCGGTAGAGTAAGC3′ Rev: 5′CTGGACTGCGGTATTGAG3′ |
Bid | Fwd: 5′CCTGGAAATAGGGAGACG3′ Rev: 5′GATACGGCAAGAATTGTGAA3′ |
Bax | Fwd: 5′AAGTAGAAGAGGGCAACCAC3′ Rev: 5′GATGGCAACTTCAACTGGG3′ |
Bcl-2 | Fwd: 5′CGGGAGAACAGGGTATGA3′ Rev: 5′CAGGCTGGAAGGAGAAGAT3′ |
PI3K | Fwd: 5′CTGGAAGCCATTGAGAAG3′ Rev: 5′CAGGATTTGGTAAGTCGG3′ |
Akt | Fwd: 5′CTCTTCTTCCACCTGTCTCG3′ Rev: 5′CTTGATGTGCCCGTCCTT3′ |
Bad | Fwd: 5′CAGGCAGCCAATAACAGT3′ Rev: 5′CCTCCATCCCTTCATCTT3′ |
β-actin | Fwd: 5′GCATAGCCACGCTTGTTCTTGAAG3′ Rev: 5′GAACCGCTCATTGCCGATAGTG3′ |
Western blotting of RARα and other signaling pathway molecules in the hippocampus and primary neurons
The protein extracted from hippocampus or primary neuron homogenates was used for western blotting. The membranes were incubated in primary antibodies including anti-RARα (1:250, Abcam, USA), anti-β-actin (1:150, Santa Cruz, USA), anti-PI3K (1:200, Abcam, USA), anti-p-Akt (1:250, Abcam, USA), anti-Akt(1:250, Cell Signaling, USA), anti-p-Bad(1:100, Santa Cruz, USA), anti-Bad (1:200, Cell Signaling, USA), anti-caspase-3(1:100, Santa Cruz, USA), anti-caspase-8(1:100, Santa Cruz, USA), anti-Bcl-2 (1:150, Santa Cruz, USA), anti-Bax(1:100, Santa Cruz, USA), and anti-Bid(1:200, Abcam, USA) at 4 °C overnight, respectively. The blot was probed with an enzyme-linked secondary antibody (typically horseradish peroxidase) for 1h at room temperature. Then, the blot was stained with 3,3′-diaminobenzidine (DAB) (Tiangen, China) and the signals from the chemiluminescent detection reagents were photographed using an ECL Imaging System (BioRad, USA). The samples were normalized to β-actin.
Statistical analysis
The statistical analyses were performed using one-way analysis of variance (ANOVA), repeated-measures ANOVA, the chi-squared test, and the Student-Newman-Keuls (SNK-q) test. All statistical analyses were computed in SPSS17 software by professional staff. The results are expressed as the means ± SEM. P ≤ 0.05 was considered significant.
Conclusions
In conclusion, after HIBD, sustained VAD caused underexpression of RARα, which downregulated PI3K/Akt/Bad and Bcl-2 signaling. The Bax, caspase-8/Bid, and caspase-3 pathways were also upregulated to reduce MMP and activate mitochondrial apoptosis, ultimately producing deficits in active learning and spatial memory in adolescence. VAS can partly repair the deficit. Meanwhile, excessively high or low RA signals can promote mitochondrial apoptosis. RA signaling bio-modulates mitochondrial apoptosis depending on the signal intensity. A high RA signal activated the PI3K/Akt/Bad pathway which failed to produce anti-apoptotic signals because caspase-8/Bid and caspase-3 signaling was upregulated. These findings suggest that clinical interventions for newborns with HIBD should include a suitable dosage of VA.
Acknowledgements
This work was supported by grants from the National Natural Science Foundation of China (No. 81571091), National Youth Foundation of China (No. 81100454), and the Key Project of the National Natural Science Foundation of China (No. 30830106).
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.