Skip to main content
Erschienen in: Acta Neuropathologica Communications 1/2016

Open Access 01.12.2016 | Research

Deletion of the type-1 interferon receptor in APPSWE/PS1ΔE9 mice preserves cognitive function and alters glial phenotype

verfasst von: Myles R. Minter, Zachery Moore, Moses Zhang, Kate M. Brody, Nigel C. Jones, Sandy R. Shultz, Juliet M. Taylor, Peter J. Crack

Erschienen in: Acta Neuropathologica Communications | Ausgabe 1/2016

insite
INHALT
download
DOWNLOAD
print
DRUCKEN
insite
SUCHEN

Abstract

A neuro-inflammatory response is evident in Alzheimer’s disease (AD), yet the precise mechanisms by which neuro-inflammation influences the progression of Alzheimer’s disease (AD) remain poorly understood. Type-1 interferons (IFNs) are master regulators of innate immunity and have been implicated in multiple CNS disorders, however their role in AD progression has not yet been fully investigated. Hence, we generated APPSWE/PS1ΔE9 mice lacking the type-1 IFN alpha receptor-1 (IFNAR1, APPSWE/PS1ΔE9 x IFNAR1−/−) aged to 9 months to investigate the role of type-1 IFN signaling in a well-validated model of AD. APPSWE/PS1ΔE9 x IFNAR1−/− mice displayed a modest reduction in Aβ monomer levels, despite maintenance of plaque deposition. This finding correlated with partial rescue of spatial learning and memory impairments in the Morris water maze in comparison to APPSWE/PS1ΔE9 mice. Q-PCR identified a reduced type-1 IFN response and modulated pro-inflammatory cytokine secretion in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice. Interestingly, immunohistochemistry displayed enhanced astrocyte reactivity but attenuated microgliosis surrounding amyloid plaque deposits in APPSWE/PS1ΔE9 x IFNAR1−/− mice in comparison to APPSWE/PS1ΔE9 mice. These APPSWE/PS1ΔE9 x IFNAR1−/− microglial populations demonstrated an anti-inflammatory phenotype that was confirmed in vitro by soluble Aβ1-42 treatment of IFNAR1−/− primary glial cultures. Our findings suggest that modulating neuro-inflammatory responses by suppressing type-1 IFN signaling may provide therapeutic benefit in AD.
Begleitmaterial
Additional file 1: Figure S1. Generation and confirmation of the APPSWE/PS1ΔE9 x IFNAR1−/− mouse. A) To generate a colony of C57BL/6 APPSWE/PS1ΔE9 x IFNAR1−/− mice with appropriate IFNAR1−/− littermate controls, heterozygous APPSWE/PS1ΔE9 mice were bred to mice homozygous for the IFNAR1 gene disruption (neomycin insert; IFNAR1−/−). The subsequent litters were termed F1 progeny and were expected to yield mice heterozygous for both the APPSWE/PS1ΔE9 mutation and IFNAR1-neoE5 allele (25 % male and 25 % female according to Mendelian inheritance). Upon genetic confirmation, APPSWE/PS1ΔE9 (het) x IFNAR1+/− mice were then interbred to generate the first APPSWE/PS1ΔE9 x IFNAR1−/− mice from F2 progeny (6.25 % male and 6.25 % female according to Mendelian inheritance). APPSWE/PS1ΔE9 (het) x IFNAR1−/− mice were then interbred to generate F3 progeny consisting of APPSWE/PS1ΔE9 x IFNAR1−/− (75 %) and IFNAR1−/− (25 %) littermates. B) Genotyping results for the initial progeny containing APPSWE/PS1ΔE9 x IFNAR1−/− and littermate IFNAR1−/− mice is displayed. Genotyping PCR was performed using a combined APPSWE/PS1ΔE9 and IFNAR1−/−. For each mouse, genotyping for APPSWE, PS1ΔE9 and IFNAR1 expression was performed in separate reactions with internal control (IC) amplification (APPSWE reactions only). The expected band sizes were as follows: APPSWE: 377 bp, PS1ΔE9: 608 bp, wildtype IFNAR1: 351 bp, IFNAR1-neomycin (IFNAR1−/−): 985 bp and IC: 324 bp. APP positive bands in lanes 2, 8 and 12 are comprised of both APPSWE and IC bands as indicated in the fig. C) Immunoblotting of Tris–HCl soluble cortical brain extracts, using mAb WO-2, revealed effective APP overexpression in APPSWE/PS1ΔE9 x IFNAR1−/− mice that was indistinguishable from levels in APPSWE/PS1ΔE9 mice. (TIF 6948 kb)
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s40478-016-0341-4) contains supplementary material, which is available to authorized users.

Introduction

Pathologically, Alzheimer’s disease (AD) is characterized by the extracellular accumulation of Aβ plaques [60] and presence of neurofibrillary tangles containing hyper-phosphorylated tau [22]. Yet targeting these proteinopathies has yet proven clinically efficacious [47]. Neuro-inflammation, involving pro-inflammatory cytokine secretion and reactive gliosis, is evident in AD [34, 37, 38, 48, 54] and epidemiological evidence suggests that this innate immune process is a key contributor to disease pathogenesis [6, 59, 67]. However the exact contribution of cytokines to the exacerbation of neuro-inflammation in AD remains unclear.
Oligomeric and fibrillar Aβ are detected by pattern recognition receptors of the innate immune system and trigger inflammasome activation [57, 58]. Many studies have utilized the APPSWE/PS1ΔE9 mouse model of AD as a tool to investigate in vivo inflammasome activation in response to Aβ production. These mice displays elevated production of Aβ1-42, leading to progressive plaque deposition and cognitive decline beginning at 6–9 months of age [30, 31]. Removal of the NLRP3 inflammasome, critical for caspase-1-mediated production of IL-1β, in APPSWE/PS1ΔE9 mice confers reductions in Aβ load, enhances LTP and rescues cognitive impairments [26]. A supportive study addressing the NLRP1 inflammasome also demonstrated that a reduced IL-1β response to amyloid is beneficial in APPSWE/PS1ΔE9 mice and reduces neuronal pyroptosis [62]. In addition, monoclonal antibodies blocking IL-12/IL-23 signaling attenuate amyloid burden and cognitive defects in APPSWE/PS1ΔE9 mice [66].
Findings from these studies suggest that microglial phenotype and function play an important role in the exacerbation and progression of AD. Upon stimulus with pro-inflammatory cytokines, microglia can polarize towards a pro-inflammatory phenotype that is deleterious to neurogenesis and synaptic plasticity. Microglial populations can also adopt an alternate anti-inflammatory phenotype that results from exposure to anti-inflammatory cytokines and promotes resolution of inflammation considered to be neuro-protective [45, 55]. These aforementioned studies demonstrate that targeting pro-inflammatory cytokine networks can attenuate neuro-inflammation, promote Aβ clearance and confer cognitive benefit in mouse models of AD by promoting anti-inflammatory activity of microglia. However, Adenoviral delivery of anti-inflammatory cytokines IL-4 or IL-10 results in deleterious effects, impeding Aβ clearance and worsening cognitive decline [10, 11]. In contrast complete removal of IL-10 promotes innate immunity and mitigates AD-like pathology in APPSWE/PS1ΔE9 mice [23]. Clearly a greater understanding of pro- and anti-inflammatory cytokine signaling is required to explain how modulating innate neuro-inflammation impacts progression of AD.
The pleiotropic type-1 IFNs regulate the aforementioned pro-inflammatory cytokine systems and are master regulators of the innate immune response [19, 33]. By signalling through the type-1 interferon receptor alpha-1 (IFNAR1) and activating the Janus associated kinase/Signal transducer and activator of transcription (JAK/Stat) pathway, type-1 IFNs can induce pro-inflammatory gene transcription generating hallmark cytokines (IL-1β, IL-6 and TNFα) that regulate immune cell recruitment and inflammatory progression. Whilst their contribution to peripheral immunity is well documented, type-1 IFNs are produced and trigger inflammatory cascades in CNS residing neurons and microglia [14, 52]. Elevated type-1 IFN levels have been linked to exacerbation numerous neuro-pathologies including Aicardi-Goutieres syndrome [17, 18] and systemic lupus erythromatosus [8]. It is now considered that a balance of interferon signalling is required for healthy brain physiology and dysregulation of this cytokine system can result in brain ‘interferonopathies’ [20]. Significantly, an exacerbated type-1 IFN response contributes to many deleterious effects associated with the aging process [3]. In addition, a type-1 IFN signature in both human AD patients and APPSWE/PS1ΔE9 mice is evident and removal IFNAR1 confers protection against soluble Aβ1-42-induced toxicity in primary cultured neurons [64].
We hypothesize that removal of type-1 IFN signaling attenuates neuro-inflammation and delays phenotypic progression in APPSWE/PS1ΔE9 mice. To test this, we generated APPSWE/PS1ΔE9 x IFNAR1−/− mice and used primary mixed astrocyte and microglial cultures and primary neuronal cultures to investigate the role of type-1 IFN signaling in AD. We find that APPSWE/PS1ΔE9 x IFNAR1−/− mice display modest reductions in monomeric Aβ load, without altering plaque deposition, and improved spatial cognitive performance. These mice exhibit a predominantly anti-inflammatory glial phenotype when compared to APPSWE/PS1ΔE9 mice alone. We confirm this anti-inflammatory glial phenotype in vitro in response to Aβ1-42 and demonstrate this polarization state protects primary neuronal cultures. Importantly, this study demonstrates that removal of type-1 IFN signaling modulates neuro-inflammation and retards phenotypic progression in the APPSWE/PS1ΔE9 mouse model of AD.

Materials and Methods

Animals

APPSWE/PS1ΔE9 transgenic mice [30] on a C57BL/6 background were sourced from JAX. (B6.Cg-Tg(APPswe,PSEN1dE9)85Dbo/Mmjax, JAX ID: 005864, https://​www.​jax.​org/​strain/​005864). IFNAR1−/− mice on a C57Bl/6 background were initially generated by [28]. APPSWE/PS1ΔE9 transgenic mice lacking IFNAR1 were generated by interbreeding. APPSWE/PS1ΔE9 and IFNAR1−/− mice to produce F1 progeny. APPSWE/PS1ΔE9 x IFNAR1+/− mice from F1 progeny were then interbred to yield APPSWE/PS1ΔE9 x IFNAR1−/− mice (F2 progeny). In all animal experiments, mice were used at 9 months of age with aged-matched littermate non-transgenic wildtype and IFNAR1−/− control mice. All mice were determined as specific pathogen-free, housed in sterile micro-isolator cages and fed ad-libitum on standard chow with open access to water. All animal procedures were performed in accordance with the University of Melbourne animal care committee’s regulations.

Animal genotyping

All animals used in this study were analysed for correct genotypes before use. This genotyping was either performed manually (Additional file 1: Figure S1), as described below, or in partnership with Transnetyx™ (Cordova, TN, USA).
Tails from mice were obtained pre-weaning and genomic DNA was extracted. Tissue was digested using Proteinase K (9.3 mg/ml, New England Biolabs) in Tris buffer (containing 1 % w/v SDS). Upon removal of protein with Potassium acetate (1.5 M) and precipitation using propan-2-ol, the extracted DNA was washed in 70 % Ethanol and reconstituted in Tris-EDTA (TE) buffer. PCR was then conducted using the GoTaq® DNA polymerase system (M3005, Promega) under the following conditions:
Step #
Temperature (°C)
Time (seconds)
Comments
1
94
180
 
2
94
30
X35 repeats
3
54
60
4
72
60
5
72
120
 
6
4
Holding temperature
PCR products were then loaded into a 2 % w/v agarose Et-Br-labelled (40 μg/ml) gel and electrophoresis was performed to separate bands. A pre-stained BenchTop 100 bp DNA ladder (G8291, Promega) was used to determine sample band sizes upon gel imaging using the ChemiDoc™ MP image system (Biorad). Specific oligonucleotide primers used for amplification of APPSWE, PS1ΔE9, IFNAR1 and internal control DNA sequences are detailed below:
Primer name
Direction (5’ → 3’)
Sequence (5’ → 3’)
Reaction concentration
oIMR3610 (APP)
Forward
AGG ACT GAC CAC TCG ACC AG
1 μM
oIMR3611 (APP)
Reverse
CGG GGG TCT AGT TCT GCA T
1 μM
oIMR1644 (PS1)
Forward
AAT AGA GAA CGG CAG GAG CA
1.33 μM
oIMR1645 (PS1)
Reverse
GCC ATG AGG GCA CTA ATC AT
1.33 μM
oIMR7338 (Control)
Forward
CTA GGC CAC AGA ATT GAA AGA TCT
0.5 μM
oIMR7339 (Control)
Reverse
GTA GGT GGA AAT TCT AGC ATC ATC C
0.5 μM
mIFNAR1E4F (IFNAR1)
Forward
CTC CTC CCG GAC AAG ACG GG
1 μM
mIFNAR1E5R (IFNAR1)
Reverse
TGG TGC TTA TAC ACT GCA CAG TGC T
1 μM
NeoF (neomycin)
Forward
GAG GCA GCG CGG CTA TCG TG
0.5 μM

In vivo study structure

The number of mice used in this study were as follows: Wildtype: 15; IFNAR1−/−: 18; APPSWE/PS1ΔE9; APPSWE/PS1ΔE9 x IFNAR1−/−: 9. Both male and female mice were used in the study in 50:50 proportion. No significant sex difference was detected in behavior and/or biochemical readouts and thus sexes were pooled. All mice were subjected to Morris water testing then 9 mice from each genotype were randomly selected for biochemical processing. Half hemispheres were taken for immunohistochemistry, whilst the other half was snap frozen and ground on liquid nitrogen in order to isolate both protein and RNA from the same mice.

Mixed cortical and hippocampal glial isolation

Mixed cortical and hippocampal neurons were isolated from embryonic P0-1 embryos as previously described [35]. Briefly, cortices were isolated and meninges surgically removed. The cleaned cortical tissue was then digested in hanks buffered sulphate solution (HBSS, 14025–092, Gibco) using trypsin/DNAse (1 mg/ml, T9201, D5025, Sigma) until a single cell suspension was achieved. Cells were then plated at a density of 1 brain/10 ml in culture medium (DMEM, 31985–062, Gibco, 20 % FBS, 0.5 % penicillin-streptomycin) in T75cm2 flasks. Media was then replaced every two days until the glial cultures formed a comprehensive monolayer. Cells were seeded at 5 x 105 cells/ml for experimental use between 14 and 28 days in vitro.

Mixed cortical and hippocampal neuron isolation

Mixed cortical and hippocampal neurons were isolated as described previously [63]. Briefly, cortices were isolated from embryonic day 14–16 pups and meninges were removed. Cleaned cortices were then digested in Krebs solution containing trypsin (250 μg/ml) and DNAse (33 μg/ml) and mechanically agitated to ensure a single cell suspension. Cells were then plated into pre-coated Poly-L-lysine (0.5 mg/ml, P6282, sigma) plastic ware at a density of 1 x 106 cells/ml in neurobasal media (17504–044, Gibco) containing B-27 growth factor supplement (17504–044, Gibco), L-glutamine (500 μM, G7513, Sigma) and 2 % FBS. The following day, FBS was removed from the media and cultures were supplemented with fresh culture media every two days until experimental use. Neuronal purity was assessed at >90 % using NeuN (neuronal nuclei) immunohistochemistry (data not shown) and all cultures were used day 9–10 in vitro.

Cardiac perfusion of mice and isolation of brain tissue

Mice were deeply anaesthetized using intra-peritoneal injection of combinatorial ketamine (90 mg/kg) and xylazine (4.5 mg/kg, K113, Sigma). Mice were cardiac perfused with ice-cold heparinized PBS (1U/ml, H3393, Sigma). Brains were then excised and separated for use in immunohistochemistry or for RNA/protein biochemical analysis. Isolation of the cortex for RNA/protein biochemistry was performed using a modified dissection technique [24]. Hemispheres were placed on an ice cold glass dissection plate and orientated in a sagittal plane. The cerebellum was removed, and the striatum, thalamus, midbrain and brain stem remnants were identified. These structures were then removed using sterilized blunt spatulas, exposing the hippocampal complex and interior wall of the cortex. The hippocampus was then peeled away from the cortex, and cortical tissue was snap frozen in liquid nitrogen and stored at −80 °C until required.

Immunohistochemistry

For immunohistochemical analysis, hemispheres were post-fixed in 4 % w/v paraformaldehyde in PBS for 72 h (4 °C) before being transferred into 30 % w/v sucrose in PBS for 48 h (4 °C) and embedded in Optimal Cutting Temperature (OCT, 4583, Sakura) medium for subsequent cryosectioning. Sagittal sections (30 μm) were then cut throughout the hippocampal region using a cryostat (Reichert-Jung) and mounted onto electrostatic Menzel-Gläser Superfrost® plus glass microscopy slides (J1800AMNZ, Thermo-Scientific). Tissue was then permeabilized in PBS-T (0.05 % v/v Tween-20, 5 min, room temperature) and blocked in CAS-Block™ (1 h, room temperature, 008120, Invitrogen). After rinsing with PBS, tissue was then incubated overnight with primary antibody diluted in 10 % v/v CAS-Block™ in PBS (4 °C, humidified chamber). After washing in PBS, slides were then incubated with fluorescent secondary antibodies diluted in 10 % v/v CAS-Block™ in PBS (2 h, room temperature). Post-PBS rinse coverslips were mounted in Vectashield® DAPI-containing mounting media (H-1200, Vector laboratories). Images were then obtained using a Zeiss Axio Observer.Z1 (Carl Zeiss imaging) inverted fluorescence microscope. Details of antibodies used for immunohistochemistry are provided below:
Antibody
Supplier
Source
Dilution
GFAP
Dako (Z0334)
Rabbit pAb
1:1000
IBA-1
Wako (019–19741)
Rabbit pAb
1:300
WO-2
(Wun et al., 2008 [68])
Mouse mAb IgG1
1:500
Alexa Fluor® 488 Goat anti-rabbit
Molecular probes (A-11008)
Goat pAb
1:1000
Alexa Fluor® 594 Goat anti-mouse
Molecular probes (A-11005)
Goat pAb
1:1000
To quantify plaque number and burden, WO-2 immunofluorescent labelled sections were converted to 8-Bit images and an image fluorescence threshold was set using Image J quantification software (NIH). Plaque staining was then analysed by particle quantification giving plaque number. The WO-2 positive pixel coverage value was then expressed relative to total cortical area to calculate cortical plaque burden. For IBA-1 and GFAP immunofluorescence quantification, integrated densities were calculated from entire cortical regions using Image J quantification software (National Institutes of Health, NIH). These values were then normalized to staining background and expressed as relative fluorescence intensity as described previously [32]. All quantified data is from average values generated from ≥3 sections/mouse (each 270 μm apart or every 6th section).

Amyloid beta preparation and cell culture treatment

Amyloid peptide stocks were prepared according to methods described previously [2]. Aβ1-42 stocks (A-42-T-1, GenecBio) were initially monomerized in 1, 1, 1, 3, 3, 3-Hexafluoro-2-propanol (0.5 mg/ml, HFIP, 52512, Fluka), lyophilized and stored at −80 °C until required. The peptide was then dissolved in ice cold 5 mM NaOH in Dulbecco’s PBS by rigorous vortexing and protein concentration was determined by absorbance spectrophotometry at 214 nm. Peptide concentrations were calculated using Eq. 1.
$$ \left[A\beta 42\right] = Ab{s}_{214}x\ \left(DF/\varepsilon \right) $$
(1)
Where Abs214 = Absorbance value of sample at 214 nm, DF = Sample dilution factor, ε = molar extinction coefficient of Aβ42 (75,887 L/mol/cm).
Primary cultured glial cells were treated with 10 μM Aβ1-42 or NaOH vehicle for up to 96 h in serum-reduced glial treatment medium (DMEM with 2 % FBS and 0.5 % penicillin-streptomycin). The final concentration of NaOH across all treatment groups was <5nM and remained non-toxic.

Protein extraction

Following treatment, primary glial cell cultures were washed in ice cold PBS and collected via cell scraping. Cell pellets were briefly sonicated in Tris lysis buffer (50 mM Tris, 150 mM NaCl, 1 % v/v Triton x-100 (T8787, Sigma), 1 % w/v SDS, PhosphoSTOP® phosphatase and cOmplete® protease inhibitors (04906837001, 11697498001, Roche), pH 7.4). Brain tissue was homogenized in Tris lysis buffer (≤100 mg/ml concentration, without 1%w/v SDS). Upon rotation for 90 min at 4 °C, homogenates were centrifuged (12,000xg, 4 °C, 5 min) before supernatants were removed and stored at −80 °C until required. Protein concentrations were determined as per the method of Bradford ([5], 500–0006, Bio-Rad).

SDS-PAGE gel electrophoresis and Western blotting

Fifty micrograms of protein was denatured in reducing buffer (20 mM Tris, 20%v/v glycerol, 4%w/v SDS, 10 % β-mecaptoethanol (M6250, Sigma), and bromophenol blue). Samples were loaded onto 10 % SDS-PAGE gels (60 mM Tris, 0.1 % w/v SDS, 0.1 % w/v APS, 0.01 % v/v TEMED, 10 % Acrylamide/Bis (161–0156, Bio-Rad)) or 4-20 % Mini-PROTEAN® TGX Stain-Free™ gels (456–8093, Bio-Rad) and electrophoresis was performed at 120 V in Novex® Tris-Glycine SDS running buffer (LC2675-5, Invitrogen). Proteins were then transferred to polyvinylidene fluoride (PVDF) membranes by semi-dry transfer (60 mA/gel, 1.25 h) or using the TransBlot® Turbo™ transfer system (2.5MA, 7 min, 170–4155, Bio-Rad) as per manufacturer’s instructions. Membranes were blocked in 5%w/v skim milk powder in Tris buffered saline-Tween 20 (0.05 % v/v Tween-20, TBS-T) for 1 h before overnight incubation with primary antibodies at 4 °C (dilutions in 2 % w/v skim milk powder in TBS-T). Membranes were then washed in TBS-T before being incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (dilutions in 2 % w/v skim milk powder in TBS-T) for 90 min at room temperature. HRP signals were detected using an enhanced chemiluminescence (ECL™) prime Western blotting detection kit (RPN2232, Amersham) and visualized using the ChemiDoc™ MP system (Bio-Rad). For densitometry analysis, all raw pixel intensities of HRP signals from Western blots were calculated using Image J quantification software (NIH). Details of antibodies used for Western blotting are provided below:
Antibody
Supplier
Source
WB dilution
p-Stat-3 (Y705)
Cell Signaling (9145)
Rabbit mAb IgG1
1:1000
Stat-3
Cell Signaling (9132)
Rabbit pAb
1:1000
WO-2
[68]
Mouse mAb IgG1
1:2000
p-NFkB (p65, S536)
Cell Signaling (3033)
Rabbit mAb IgG1
1:1000
SOCS3
Abcam (ab723)
Goat pAb
1:200
β-actin
Sigma-Aldrich (A5441)
Mouse mAb IgG1
1:4000
G α-rabbit/HRP
Dako (P0448)
Goat pAb-HRP
1:1000
G α-mouse/HRP
Dako (P0447)
Goat pAb-HRP
1:1000

Aβ1:40 sandwich Enzyme-linked immunosorbent assay (ELISA)

For quantification of soluble and insoluble Aβ levels, tissues were homogenized in PBS (containing Triton x-100, 1 % v/v, PBS-T) containing PhosphoSTOP® phosphatase and cOmplete® protease inhibitors (04906837001, 11697498001, Roche), pH 7.4) via sonication. After centrifugation (100,000xg, 60 min, 4 °C) the supernatant was collected to detect PBS-T-soluble Aβ1:40 levels. The remaining tissue pellets were further homogenized in 70 % v/v formic acid in PBS, centrifuged (100,000xg, 60 min, 4 °C) and the resulting supernatant was neutralized with 1 M Tris base (20x volume) and collected to detect PBS-T-insoluble Aβ1:40 levels by sandwich ELISA.
Assays were run in 96-well plate format with all standards and samples run in duplicate reactions. ELISA plates were coated in WO-2 capture antibody (diluted in 0.05 M carbonate-bicarbonate, pH 9.6) overnight and blocked in 1 % BSA (diluted in TBS-T) prior to sample incubation (100 μg protein/well, 4 °C, overnight incubation with shaking). Plates were then washed in TBS-T and incubated with an anti-Aβ1:40 casein-1E8 biotinylated monoclonal sandwich detection antibody. After washing in TBS-T plates were incubated with high sensitivity Streptavidin-HRP and signals were developed using TMB substrate and detection at 450 nm. Sample absorbance were normalized to the Aβ1:40 standard curve and concentrations are expressed relative to sample total protein concentrations as determined by Bradford assay.

RNA isolation and cDNA synthesis

RNA was extracted from cell pellets or brain tissue by methods previously described [12] using TRIzol® reagent (15596018, Life-Technologies). Contaminating genomic DNA was then removed prior to reverse transcription using the TURBO DNA-free™ kit (AM1907, Ambion) according to manufacturer’s guidelines. Yield quantities and purity of the RNA product was then assessed using the nanodrop 1000 spectrophotometer (Thermo Scientific). One microgram of RNA was then reverse transcribed to produce cDNA using a high capacity cDNA reverse transcription kit (4368814, Applied Biosciences) as per manufacturer’s instructions and cDNA was then diluted 1:3 in diethylpyrocarbonate (DEPC)-treated dH2O for use in QPCR.

Quantitative PCR

All QPCR was performed in standard 384-well plates (4309849, Applied Biosystems) using the 7900ht fast real-time PCR system (Applied Biosystems) and reactions for a given sample were performed in triplicate. All Taqman gene expression assays were purchased commercially (431182, Applied Biosystems) and reactions were performed under the following thermal conditions:
Step #
Temperature (°C)
Time (minutes)
Comments
1
50
2
-
2
94.5
10
-
3
97
0.5
X40 repeats
4
59.7
1
For SYBR® green-based detection, gene-specific primers were synthesized commercially (Geneworks) and reactions were performed under the following thermal conditions:
Step #
Temperature (°C)
Time (minutes)
Comments
1
95
20
-
2
95
0.5
X40 repeats
3
60
1.5
4
95
15
-
5
60
15
-
6
95
15
-
Fold change readouts presented throughout the study were calculated using the ΔΔct calculation method [36]. For each experiment a fluorescence detection threshold was automatically set at 1.0 RFU and the cycle number at which each reaction reached this threshold was calculated (cycle threshold (Ct)). Triplicate Ct value for genes of interest were then normalized back to the Ct values of the GAPDH housekeeping gene to account for differences in original cDNA concentration between samples (ΔCt). The calculated ΔCt of treatment or genotype groups were then normalized back to the ΔCt of appropriate genotype-specific control samples. In addition, ΔΔCt values were converted to fold change data using Eq. 2.
$$ Fold\ change = {2}^{\left(-\varDelta \varDelta ct\right)} $$
(2)
Primers used for QPCR analysis are listed below:
Gene
Species
Inventory number
GAPDH
Mouse
Mm99999915_m1
IFNβ
Mouse
Mm00439552_s1
IRF7
Mouse
Mm00516788_m1
IRF3
Mouse
Mm00516779_m1
IRF8
Mouse
Mm00492567_m1
IL-1β
Mouse
Mm01336189_m1
IL-6
Mouse
Mm00446190_m1
TNFα
Mouse
Mm00443258_m1
CD33
Mouse
Mm00491152_m1
TREM2
Mouse
Mm04209422_m1
Gene
Direction (5’ → 3’)
Sequence (5’ → 3’)
GAPDH
Forward
ATCTTCTTGTGCAGTGCCAGC
Reverse
ACTCCACGACATACTCAGCACC
IFNα
Forward
GCAATCCTCCTAGACTCACTTCTGCA
Reverse
TATAGTTCCTCACAGCCAGCAG
IFNαE4
Reverse
TATTTCTTCATAGCCAGCTG
iNOS
Forward
CAAGCACCTTGGAAGAGGAG
Reverse
AAGGCCAAACACAGCATACC
CD32
Forward
AATCCTGCCGTTCCTACTGATC
Reverse
GTGTCACCGTGTCTTCCTTGAG
CD11b
Forward
CCAAGACGATCTCAGCATCA
Reverse
TTCTGGCTTGCTGAATCCTT
CD206
Forward
CAAGGAAGGTTGGCATTTGT
Reverse
CCTTTCAGTCCTTTGCAAGC
ARG1
Forward
TCACCTGAGCTTTGATGTCG
Reverse
CTGAAAGGAGCCCTGTCTTG
CCL22
Forward
CTGATGCAGGTCCCTATGGT
Reverse
GCAGGATTTTGAGGTCCAGA
TGFβ
Forward
TGCGCTTGCAGAGATTAAAA
Reverse
CGTCAAAAGACAGCCACTCA
YM1
Forward
CAGGGTAATGAGTGGGTTGG
Reverse
CACGGCACCTCCTAAATTGT

MTS cell viability assay

Cell viability was measured by the ability to metabolize 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, CellTiter 96® AQueous non-radioactive cell proliferation assay, G5421, Promega) in the presence of the electron coupler phenazine methosulfate (PMS) to a media soluble formazan product, as described previously [9]. Combined MTS (400 μg/ml) and PMS (44 μg/ml) solution was incubated on primary cultured neurons for 4 h (37 °C). Culture medium absorbance at 492 nm was then determined using a Multiskan Ascent spectrophotometer (Thermo Scientific). All sample absorbance readings were then blank normalized using a negative control reaction containing only culture medium and the MTS/PMS reagent. Absorbance readings of all treatment groups were then normalized back to genotype-specific vehicle controls and expressed as a percentage of vehicle control cell viability. Experiments were performed in technical triplicate and staurosporine (1 μM, S6942, Sigma) was used to induce cellular apoptosis in primary neuronal cultures for positive control means.

Morris water maze

Morris water maze (MWM) testing was conducted in a black circular pool 1.6 m in diameter and 0.8 m deep. A white Perspex 10 cm2 circular platform was then secured to the enclosure 25 cm from the pool wall. The pool was then filled with water at 21–23 °C until the white platform was submerged 1 cm below the surface. Non-toxic, water soluble white ceiling paint (Taubmans) was then used to opacify the water. The room was brightly illuminated using wall-mounted halogen lamps. Several distinct and distal extra-maze cues were placed around the pool as points of reference. These cues remained in place throughout the duration of testing and the platform was only removed to conduct the probe trial.
Mice were subjected to a 4 trial/day protocol for 7 days with 60 s maximum trial duration. Mice were removed from their test cage and placed into the water maze, at a randomized cardinal point, facing towards the pool wall. The 60 s trial commenced after the mouse had entered the MWM for 2 s. If the test mouse found, mounted and stayed on the hidden platform for 2 s the trial was deemed complete and latency to reach the platform was calculated. The mouse remained on the hidden platform for 20 s before being removed from the water maze and placed back in their testing cage. If the mouse failed to find or remain on the platform for at least two seconds before the 60 s time allowance, the researcher entered the testing area and guided the mouse to the hidden platform. Once an individual mouse completed the trial and was towel dried, the next mouse within the testing group was immediately placed into the MWM for testing. Each mouse underwent 4 trials per day, according to the aforementioned trial parameters and had an inter-trial resting time of 10 min. All MWM testing was recorded to DVD and automatically tracked using Ethovision® XT (Noldus). For all individual trials, latency to platform, success rate, path length and swim speed was calculated. A 60 s value for latency was awarded for all trials where the test mouse failed to find the platform within the allocated time.
To assess spatial reference memory, a probe trial was conducted on day 7 of MWM acquisition. Mice were placed into the maze at the north cardinal point and allowed to explore for the standard 60 s trial length with the escape platform removed. The maze was virtually divided up into quadrants and time spent in the quadrant which previously held the platform was calculated. All primary readouts reported from MWM testing conducted in this study are well-established in the AD field [7].

Statistical analysis

GraphPad Prism software (version 6.0, http://​www.​graphpad.​com/​scientific-software/​prism/​) was used for all t-tests, ANOVAs and post-hoc statistical evaluation. Where comparisons of multiple groups was required a one or two-way analysis of variance (ANOVA) was performed, with mouse genotype as the fixed variable. A Bonferroni post-hoc or Tukey’s HSD multiple comparisons test was then performed. Otherwise an unpaired two-tailed Student’s t-test was used. For all statistical tests a two-tailed α value of 0.05 was utilized. Box plots were used to display data in which the midline represents the median value and the upper and lower margins equate to the 25 % and 75 % quartiles. The whiskers display data within the 1.5xinterquartile range and values beyond this were determined as outliers (represented as circles). All other numerical data is presented as mean ± SEM. Power values for each test where calculated post-hoc using G*Power (version 3.1, http://​gpower.​hhu.​de/​), based upon the effect size, group number and sample size. Exact p-values were calculated for all Student’s t-tests and multiplicity adjusted p-values were determined for all Bonferroni’s and Tukey’s post-hoc tests. A p-value <0.05 was considered statistically significant. All use of statistics is detailed in Additional file 2: Table S1.

Results

Removal of IFNAR1 in APPSWE/PS1ΔE9 mice confers modest reductions in cortical Aβ monomer load but plaque burden remains unaltered

To investigate the effect of removing type-1 IFN signaling in AD we generated APPSWE/PS1ΔE9 x IFNAR1−/−. APPSWE/PS1ΔE9 mice aged 9 months display an enhanced type-1 IFN and pro-inflammatory cytokine response [64]. Hence, we focused on characterizing phenotypic alterations in APPSWE/PS1ΔE9 x IFNAR1−/− mice at this age. With variable hippocampal Aβ plaque deposition at this age in both APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mice (data not shown), the current study focused on cortical regions only, not hippocampus. To assess potential alterations in Aβ plaque burden, immunohistochemistry was performed on APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mouse brain sagittal sections, stained with anti-Aβ mAb WO-2 (n = 9 per genotype, Fig. 1a, b). Both APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mice display extensive plaque deposition within cortical regions but no difference was detected between genotypes when Aβ plaques were counted (n = 9 per genotype, Fig. 1c) or when cortical plaque burden percentage was quantified (n = 9 per genotype, Fig. 1d). To validate these immunohistochemical findings we prepared PBS-T-soluble and PBS-T-insoluble fractions from cortical tissue to quantify Aβ levels by ELISA. We did not observe any differences in PBS-T-soluble or PBS-T-insoluble Aβ1:40 levels measured from cortical tissue lysates of APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mice (n = 4–6 per genotype, Fig. 1e, d). These findings suggest that removal of type-1 IFN signaling in APPSWE/PS1ΔE9 mice does not influence amyloid plaque deposition at 9 months of age.
Whilst amyloid plaque levels remained unchanged in the APPSWE/PS1ΔE9 IFNAR1−/− mouse, the oligomerization state of soluble Aβ species may be altered. This can influence peptide toxicity and potentially impact cognitive phenotypes [1, 15, 44]. To investigate the oligomerization state of various Aβ species, we analyzed Tris–HCl soluble cortical fractionations from wildtype, IFNAR1−/−, APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mice by western blotting, probed with anti-Aβ mAb WO-2 (n = 4–6 per genotype, Fig. 1g). Analysis of Aβ oligomers in wildtype and IFNAR1−/− mice displayed constitutive Aβ production but not overexpression that is characteristic of the APPSWE/PS1ΔE9 transgene. Densitometry identified a trend, albeit not statistically significant, to decreased transgenic human APP-CTF expression (n = 4–6 per genotype, p = 0.0618, Fig. 1h) and significant reductions in endogenous murine APP-CTF levels (n = 4–6 per genotype, p < 0.0001, Fig. 1i) in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice. Densitometry confirmed a significant 4.3 ± 0.2-fold decrease of cortical Aβ monomer levels in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice (n = 4–6 per genotype, p = 0.0122, Fig. 1j). Although not statistically significant, Aβ trimer (3-mer) levels also trended to a decrease in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice (n = 4–6 per genotype, p = 0.0569, Fig. 1k). Collectively, this data highlights that removal of IFNAR1 in APPSWE/PS1ΔE9 mice does not influence Aβ plaque deposition, but may influence oligomerization through modest, but significant, reductions in Aβ monomer levels.

Spatial learning and memory defects in APPSWE/PS1ΔE9 mice are improved upon removal of IFNAR1

To assess if removal of type-1 IFN signaling can alleviate the cognitive deficits observed in APPSWE/PS1ΔE9 we analyzed spatial learning and memory performance of wildtype, IFNAR1−/−, APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mice using the Morris water maze. Compared to wildtype, APPSWE/PS1ΔE9 mice required more time to find the escape platform, whilst APPSWE/PS1ΔE9 x IFNAR1−/− mice were initially impaired but recovered to wildtype levels as pheno-copied by IFNAR1−/− mice (n = 9–18 per genotype, 0.05 < p < 0.001, Fig. 2a). Compared to wildtype, an initial decline in trial success rate was seen for all genotypes but this was only maintained by the APPSWE/PS1ΔE9 mice over the course of acquisition (n = 9–18 per genotype, 0.05 < p < 0.0001, Fig. 2b). Compared to wildtype, all genotypes initially selected longer escape paths but only APPSWE/PS1ΔE9 mice maintained this abnormality throughout testing (n = 9–18 per genotype, p < 0.01, Fig. 2c). Representative tracks (Day 7 acquisition) of APPSWE/PS1ΔE9 mice display a lack of cue-directed swimming to find the platform, partially rectified in the APPSWE/PS1ΔE9 IFNAR1−/− counterparts. Wildtype and IFNAR1−/− behaved similarly (Fig. 2d, Additional file 2: Table S1 for detailed analysis).
After the 7 day acquisition period, the escape platform was removed from the maze and persistence of the mouse to escape was measured. Although not statistically significant, APPSWE/PS1ΔE9 x IFNAR1−/− mice spent more time exploring the escape quadrant than APPSWE/PS1ΔE9 mice (APPSWE/PS1ΔE9: 27.3 ± 3.8 % vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 39.0 ± 7.7 %, n = 9–18 per genotype, p = 0.5111, Fig. 2e). Interestingly, IFNAR1−/− mice spent a significantly greater amount of time in the escape quadrant than APPSWE/PS1ΔE9 mice (IFNAR1−/−: 45.6 ± 0.5 % vs. APPSWE/PS1ΔE9: 27.3 ± 3.8 %, n = 9–18 per genotype, p = 0.0488, Fig. 2e). As swimming ability can represent a potential confounding factor in the Morris water maze, average swim speed was measured. APPSWE/PS1Δ9 mice swim at a significantly lower velocity than their wildtype counterparts (Wildtype: 18.5 ± 0.5 cm/s vs. APPSWE/PS1Δ9: 15.9 ± 0.4 cm/s, n = 9–18 per genotype, p = 0.0025, Fig. 2f); however this difference at a physiological level is minor and observed swimming technique remained consistent amongst genotypes. Collectively, this data implicates that removal of type-1 IFN signaling in APPSWE/PS1ΔE9 mice rescues spatial learning and memory deficits assessed using the Morris water maze.

The type-1 IFN and pro-inflammatory cytokine response is attenuated in APPSWE/PS1ΔE9 x IFNAR1−/− mice

Previously it has been demonstrated that removal of IFNAR1 attenuates the type-1 IFN response to soluble Aβ1-42 in primary cultured neurons and confers neuro-protection [64]. To investigate alterations in the type-1 IFN response in APPSWE/PS1ΔE9 x IFNAR1−/− mice, Q-PCR was performed on cortical tissue. Levels of IFNα expression were significantly elevated in APPSWE/PS1ΔE9 mice compared to wildtype mice with this elevation attenuated in APPSWE/PS1ΔE9 x IFNAR1−/− mice (Wildtype: 1.0 ± 0.08-fold vs. APPSWE/PS1ΔE9: 3.4 ± 0.8-fold, p = 0.0009; APPSWE/PS1ΔE9: 3.4 ± 0.8-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.3 ± 0.1-fold, p = 0.0063, n = 9 per genotype, Fig. 3a). This data confirms that aged APPSWE/PS1ΔE9 display enhanced type-1 IFNα expression that is IFNAR1-dependent. We also analyzed IFNβ transcript levels in both wildtype and APPSWE/PS1ΔE9 cortical tissue but were unable to detect a difference between genotypes (n = 7 per genotype, Additional file 3: Figure S2).
As IRF7 and IRF3 are critical mediators of IFNα [27] and IFNβ [56] production respectively, mRNA levels were also analyzed to assess the capacity for type-1 IFN production in these mice. Levels of IRF7 expression were significantly elevated in APPSWE/PS1ΔE9 mice compared to wildtype mice, implying elevated capacity for IFNα production in these mice (Wildtype: 1.1 ± 0.08-fold vs. APPSWE/PS1ΔE9: 2.2 ± 0.3-fold, p < 0.0001, n = 9 per genotype, Fig. 3a). This elevation in IRF7 was attenuated in APPSWE/PS1ΔE9 x IFNAR1−/− mice (APPSWE/PS1ΔE9: 2.2 ± 0.3-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 0.3 ± 0.03-fold, p < 0.0001, n = 9 per genotype, Fig. 3a). Interestingly, IFNAR1−/− mice exhibit basal reductions in IRF7 expression levels compared to wildtype mice (Wildtype: 1.1 ± 0.08-fold vs. IFNAR1−/−: 0.2 ± 0.02-fold, p = 0.0019, n = 9 per genotype, Fig. 3a). Expression levels of IRF3 were significantly elevated in APPSWE/PS1ΔE9 mice compared to wildtype mice (Wildtype: 1.1 ± 0.06-fold vs. APPSWE/PS1ΔE9: 1.5 ± 0.1-fold, p = 0.0004, n = 9 per genotype, Fig. 3a). However no alteration was detected when IRF3 levels in APPSWE/PS1ΔE9 mice were compared to APPSWE/PS1ΔE9 x IFNAR1−/−, implying that signaling through IFNAR1 does not regulate IRF3 expression in these mice (APPSWE/PS1ΔE9: 1.5 ± 0.1-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.4 ± 0.09-fold, p = 0.4369, n = 9 per genotype, Fig. 3a). We also analyzed transcript levels of IRF8, a type-1 IFN-regulated mediator important in microglial activation and phenotype [40]. Levels of IRF8 expression were significantly elevated in APPSWE/PS1ΔE9 mice compared to wildtype mice (Wildtype: 1.1 ± 0.07-fold vs. APPSWE/PS1ΔE9: 1.7 ± 0.2-fold, p = 0.0009, n = 9 per genotype, Fig. 3a) and this elevation was maintained in APPSWE/PS1ΔE9 x IFNAR1−/− mice (APPSWE/PS1ΔE9: 1.7 ± 0.2-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.9 ± 0.1-fold, p = 0.3845, n = 9 per genotype, Fig. 3a).
Considering type-1 IFNs signal via the JAK-Stat cascade and induce pro-inflammatory cytokine transcription, phosphorylation of Stat-3 was analyzed as a reporter of net type-1 IFN signaling in the APPSWE/PS1ΔE9 x IFNAR1−/− mice. Western blotting confirmed elevated phosphorylation of Stat-3 in APPSWE/PS1ΔE9 mice compared to both wildtype and IFNAR1−/− mice (n = 4 per genotype, Fig. 3b). Densitometry of these blots identified a trend for decreased Stat-3 activation in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice (APPSWE/PS1ΔE9: 2.4 ± 0.8-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.1 ± 0.4-fold, p = 0.1955, n = 4 per genotype Fig. 3c). Collectively, these data highlight that removal of IFNAR1 attenuates the type-1 IFN response in aged APPSWE/PS1ΔE9 mice, correlating with cognitive benefits and modest reductions in Aβ monomer load.
Type-1 IFNs are master regulators of the innate immune response, regulating pro-inflammatory cytokine production [33]. To investigate if the removal of type-1 IFN signaling alters pro-inflammatory cytokine secretion in APPSWE/PS1ΔE9 mice, Q-PCR analyzing cortical tissue was performed. IL-1β mRNA transcript levels were upregulated in the APPSWE/PS1ΔE9 mice compared wildtype mice (Wildtype: 1.1 ± 0.09-fold vs. APPSWE/PS1ΔE9: 3.1 ± 0.4-fold, p < 0.0001, n = 9 per genotype, Fig. 3d). Interestingly, APPSWE/PS1ΔE9 x IFNAR1−/− mice displayed elevated IL-1β mRNA levels compared to APPSWE/PS1ΔE9 mice alone (APPSWE/PS1ΔE9: 3.1 ± 0.4-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 4.5 ± 0.5-fold, p = 0.0071, n = 9 per genotype, Fig. 3d). Whilst IL-6 expression levels were significantly elevated in APPSWE/PS1ΔE9 mice when compared to wildtype mice, this response was not significantly altered in APPSWE/PS1ΔE9 x IFNAR1−/− mice (Wildtype: 1.1 ± 0.1-fold vs. APPSWE/PS1ΔE9: 2.0 ± 0.2-fold, p = 0.0005, n = 9 per genotype, Fig. 3d). TNFα mRNA transcript levels were upregulated in the APPSWE/PS1ΔE9 mice compared wildtype mice (Wildtype: 1.0 ± 0.09-fold vs. APPSWE/PS1ΔE9: 2.2 ± 0.2-fold, p < 0.0001, n = 9 per genotype, Fig. 3d) Significantly, TNFα expression was reduced in the APPSWE/PS1ΔE9 IFNAR1−/− mice compared to APPSWE/PS1ΔE9 counterparts (APPSWE/PS1ΔE9: 2.2 ± 0.2-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.4 ± 0.1-fold, p = 0.0037, n = 9 per genotype, Fig. 3d). These data suggest that type-1 IFN signaling through IFNAR1 is an important regulator of pro-inflammatory cytokine expression in APPSWE/PS1ΔE9 mice.

APPSWE/PS1ΔE9 x IFNAR1−/− mice exhibit enhanced astrocyte reactivity but attenuated microgliosis surrounding amyloid deposition

Both microgliosis and astrocyte reactivity are important hallmarks of the neuro-inflammation evident in AD and are primary sources of pro-inflammatory cytokine production [25]. To establish if removal of type-1 IFN signaling alters astrocyte reactivity in APPSWE/PS1ΔE9 mice, immunohistochemistry was performed. Representative images and fluorescence quantification of sagittaly sectioned cortex revealed a significant 2.2 ± 0.3-fold increase in GFAP reactivity in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 counterparts (p = 0.0006, n = 9 per genotype, Fig. 4a, b). High power magnification images demonstrate this elevated astrocyte reactivity surrounds Aβ plaques, generating a localized inflammatory environment (Fig. 4c). Collectively, this data highlights that removal of IFNAR1 triggers increased astrocyte reactivity in cortical areas of Aβ accumulation in APPSWE/PS1ΔE9 mice. However, further investigation is required to conclude if this is a compensatory or direct effect of removing type-1 IFN signaling in APPSWE/PS1ΔE9 mice.
To assess if ablation of type-1 IFN signaling affects microgliosis in APPSWE/PS1ΔE9 mice further immunohistochemistry was performed. Representative images and fluorescence quantification of sagittaly sectioned cortex revealed a significant 1.5 ± 0.09-fold decrease in IBA-1 reactivity in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 counterparts (p = 0.0032, n = 9 per genotype, Fig. 4d, e). High power magnification images demonstrate a hypertrophic and reactive microglial phenotype surrounding Aβ plaques in the APPSWE/PS1ΔE9 mice. IBA-1 positive cells detected in APPSWE/PS1ΔE9 x IFNAR1−/− display decreased staining intensity and remain embedded within plaque deposition, adopting a different morphology than cells in APPSWE/PS1ΔE9 mice (Fig. 4f). These findings suggest that ablation of type-1 IFN signaling in APPSWE/PS1ΔE9 mice attenuates cortical microgliosis and alters cellular morphology within the amyloid plaque microenvironment.

Removal of IFNAR1 shifts elevates expression of anti-inflammatory glial phenotypic markers in APPSWE/PS1ΔE9 mice

It has been suggested that pro-inflammatory microglial phenotypes enhance are largely deleterious in AD whereas anti-inflammatory microglial activity can promote beneficial inflammatory resolution [53]. We have shown that altered gliosis, decreased type-1 IFN responses and altered pro-inflammatory cytokine secretion is evident in APPSWE/PS1ΔE9 x IFNAR1−/− mice, thus we were interested in assessing expression of glial inflammatory phenotypic markers. Cortical tissue from wildtype, IFNAR1−/−, APPSWE/PS1ΔE9 and APPSWE/PS1ΔE9 x IFNAR1−/− mice were analyzed by Q-PCR for pro- and anti-inflammatory glial phenotype markers.
Elevation of iNOS pro-inflammatory marker expression was confirmed in APPSWE/PS1ΔE9 mice compared to wildtype mice (Wildtype: 1.1 ± 0.1-fold vs. APPSWE/PS1ΔE9: 2.6 ± 0.4-fold, p < 0.0001, n = 9 per genotype, Fig. 5a). Significantly, iNOS expression was decreased in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice alone (APPSWE/PS1ΔE9: 2.6 ± 0.4-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.4 ± 0.1-fold, p = 0.0053, n = 9 per genotype, Fig. 5a). Transcript levels of the pro-inflammatory marker CD11b were elevated in APPSWE/PS1ΔE9 mice compared to wildtype mice (Wildtype: 1.0 ± 0.07-fold vs. APPSWE/PS1ΔE9: 2.4 ± 0.4-fold, p = 0.0014, n = 9 per genotype, Fig. 5a). Similar to the iNOS expression, CD11b transcript levels were decreased in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 mice alone (APPSWE/PS1ΔE9: 2.4 ± 0.4-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.4 ± 0.1-fold, p = 0.0371, n = 9 per genotype, Fig. 5a). Expression of the CD32 pro-inflammatory marker was elevated in APPSWE/PS1ΔE9 mice compared to wildtype, however this elevation was not suppressed in APPSWE/PS1ΔE9 x IFNAR1−/− mice (Wildtype: 1.1 ± 0.1-fold vs. APPSWE/PS1ΔE9: 3.7 ± 0.6-fold, p < 0.0001, n = 9 per genotype, Fig. 5a). Indeed, CD32 levels in APPSWE/PS1ΔE9 x IFNAR1−/− mice were elevated compared to wildtype mice albeit not to the same levels as APPSWE/PS1ΔE9 mice (Wildtype: 1.1 ± 0.1-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 2.5 ± 0.3-fold, p = 0.0366, n = 9 per genotype, Fig. 5a). Expression of the CD33 pro-inflammatory marker was elevated in APPSWE/PS1ΔE9 mice compared to wildtype, but this elevation was not suppressed in APPSWE/PS1ΔE9 x IFNAR1−/− mice (Wildtype: 1.0 ± 0.05-fold vs. APPSWE/PS1ΔE9: 1.9 ± 0.3-fold, p = 0.0015, n = 9 per genotype, Fig. 5a).
Analysis of the anti-inflammatory marker TGFβ revealed elevated expression levels in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to wildtype mice (Wildtype: 1.0 ± 0.06-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 1.6 ± 0.2-fold, p = 0.0189, n = 9 per genotype, Fig. 5b). This elevation was not present in the APPSWE/PS1ΔE9 cohort. Transcript levels of the YM1 anti-inflammatory marker were also elevated in APPSWE/PS1ΔE9 x IFNAR1−/− mice when compared to both wildtype and APPSWE/PS1ΔE9 mice (Wildtype: 1.2 ± 0.2-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 2.5 ± 0.5-fold, p = 0.0061; APPSWE/PS1ΔE9: 1.4 ± 0.2-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 2.5 ± 0.5-fold, p = 0.0490, n = 9 per genotype, Fig. 5b). ARG1 anti-inflammatory marker expression levels were elevated in APPSWE/PS1ΔE9 x IFNAR1−/− mice when compared to both wildtype and APPSWE/PS1ΔE9 cohorts (Wildtype: 1.2 ± 0.1-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 3.0 ± 0.5-fold, p = 0.0002; APPSWE/PS1ΔE9: 1.7 ± 0.2-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 3.0 ± 0.5-fold, p = 0.0141, n = 9 per genotype, Fig. 5b). Expression levels of both CD206 and CCL22 M2 markers remained constant amongst all genotypes (n = 9 per genotype, Fig. 5b). Transcript levels of the TREM2 anti-inflammatory marker were elevated in APPSWE/PS1ΔE9 x IFNAR1−/− mice when compared to both wildtype and APPSWE/PS1ΔE9 mice (Wildtype: 1.0 ± 0.07-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 2.5 ± 0.2-fold, p < 0.0001; APPSWE/PS1ΔE9: 2.0 ± 0.1-fold vs. APPSWE/PS1ΔE9 x IFNAR1−/−: 2.5 ± 0.2-fold, p = 0.0056, n = 9 per genotype, Fig. 5b). Of interest is the finding that elevations in TREM2 expression were not unique to the APPSWE/PS1ΔE9 x IFNAR1−/− genotype but also observed in APPSWE/PS1ΔE9 mice when compared to wildtype counterparts (Wildtype: 1.0 ± 0.07-fold vs. APPSWE/PS1ΔE9: 2.0 ± 0.1-fold, p < 0.0001, n = 9 per genotype, Fig. 5b). Western blot analysis of the anti-inflammatory marker SOCS-3, a negative regulator of type-1 IFN signaling and cytokine production [61, 69], confirmed an up-regulation in APPSWE/PS1ΔE9 x IFNAR1−/− mice compared to APPSWE/PS1ΔE9 counterparts. This up-regulation was also confirmed in IFNAR1−/− mice alone when compared to wildtype mice (Fig. 5c).
From the summarized data depicting pro-inflammatory (Fig. 5d) and anti-inflammatory glial phenotypic marker expression (Fig. 5e), these findings implicate that removal of type-1 IFN signaling shifts the glial phenotype from a pro-inflammatory phenotype towards an anti-inflammatory and presumably neuro-protective phenotype in APPSWE/PS1ΔE9 mice.

Removal of IFNAR1 attenuates the type-1 IFN and pro-inflammatory cytokine response in response to Aβ1-42 in primary glial cultures

Astrocytes and microglia are key contributors to the inflammatory phenotype in AD and are also sources of type-1 IFN production within the CNS [51]. To investigate the role of astroglial and microglial type-1 IFN production in response to Aβ1-42, the predominant Aβ species over-produced in APPSWE/PS1ΔE9 mice [30, 31], we adopted an in vitro approach using primary cultured mixed glial cultures. Wildtype and IFNAR1−/− glia were treated with 10 μM Aβ1-42 for 24–96 h and Q-PCR was used to assess IFNα and IFNβ expression. At 72 and 96 h post-treatment IFNAR1−/− glia displayed reduced IFNα (72 h: Wildtype: 12.7 ± 1.8-fold vs. IFNAR1−/−: 1.4 ± 0.1-fold, p < 0.0001; 96 h: Wildtype: 9.1 ± 4.4-fold vs. IFNAR1−/−: 1.3 ± 0.2-fold, p = 0.0007, n = 4–5 per genotype, Fig. 6a) and IFNβ expression (72 h: Wildtype: 6.4 ± 1.3-fold vs. IFNAR1−/−: 0.7 ± 0.2-fold, p = 0.0006; 96 h: Wildtype: 6.3 ± 2.1-fold vs. IFNAR1−/−: 0.9 ± 0.3-fold, p = 0.0012, n = 4–5 per genotype, Fig. 6a) compared to wildtype cultures. In contrast to our in vivo data, Western blotting and subsequent densitometry revealed that Aβ1-42 treatment did not induce a p-Stat-3 response in either wildtype or IFNAR1−/− glial cultures, displaying a comparable expression level (Additional file 4: Figure S3). Overall these findings identify a glial-derived type-1 IFN response to Aβ1-42. Furthermore this type-1 IFN response is attenuated upon removal of IFNAR1, in line with the notion that IFNAR1 is critical in autocrine up-regulation of type-1 IFNs in response to inflammatory stimuli [13, 29].
To investigate if ablation of type-1 IFN signaling decreases the pro-inflammatory cytokine burden in Aβ1-42-treated glial cultures, further Q-PCR analysis was conducted. At 24 and 48 h post-treatment, the IL-1β response to Aβ1-42 was decreased in IFNAR1−/− cultures compared to wildtype glia (24 h: Wildtype: 10.9 ± 4.4-fold vs. IFNAR1−/−: 0.8 ± 0.4-fold, p = 0.0105; 48 h: Wildtype: 10.8 ± 3.8-fold vs. IFNAR1−/−: 0.4 ± 0.1-fold, p = 0.0074, n = 4–5 per genotype, Fig. 6a). Wildtype glia generated an elevated IL-6 response upon Aβ1-42 insult that was attenuated in IFNAR1−/− cultures at 96 h (Wildtype: 2.7 ± 0.9-fold vs. IFNAR1−/−: 0.3 ± 0.04-fold, p = 0.0259, n = 4–5 per genotype, Fig. 6a). Expression of TNFα after 24 and 96 h of Aβ1-42 treatment was also reduced in IFNAR1−/− glia compared to wildtype counterparts (24 h: Wildtype: 7.2 ± 2.6-fold vs. IFNAR1−/−: 0.6 ± 0.05-fold, p = 0.0003; 96 h: Wildtype: 4.8 ± 0.4-fold vs. IFNAR1−/−: 0.2 ± 0.09-fold, p = 0.0034, n = 4–5 per genotype, Fig. 6a). These data suggest that type-1 IFN signaling regulates further pro-inflammatory cytokine production in glial cells exposed to Aβ1-42.
Type-1 IFNs can regulate the activity of NFkB, which is required for robust immune responses [50, 65]. To ascertain if attenuation of the type-1 IFN and pro-inflammatory cytokine response to Aβ1-42 observed in IFNAR1−/− glial cultures resulted in reduced NFkB (p65) activation, further western blotting was performed (n = 3 per genotype, Fig. 6b). Densitometry quantification identified phosphorylation of NFkB (p65) was decreased in Aβ1-42-treated IFNAR1−/− glia across the entire treatment course when compared to wildtype cultures (24 h: Wildtype: 2.2 ± 0.2-fold vs. IFNAR1−/−: 0.9 ± 0.08-fold, p = 0.0001; 48 h: Wildtype: 2.1 ± 0.1-fold vs. IFNAR1−/−: 1.2 ± 0.08-fold, p = 0.0007; 72 h: Wildtype: 1.8 ± 0.2-fold vs. IFNAR1−/−: 0.8 ± 0.06-fold, p = 0.0002, n = 3 per genotype, Fig. 6c). Collectively this data suggests that type-1 IFN signaling regulates the pro-inflammatory glial response to Aβ1-42.

Wildtype glia adopt a pro-inflammatory phenotype in response to Aβ1-42, whereas IFNAR1−/− cultures display enhanced expression of anti-inflammatory phenotypic markers

Within the current study we have demonstrated that removal of IFNAR1 confers an anti-inflammatory glial response in APPSWE/PS1ΔE9 mice. Thus we were interested in confirming this phenotype in Aβ1-42-treated IFNAR1−/− glial cultures that display attenuated pro-inflammatory responses. To analyze the polarization phenotype in response to Aβ1-42, wildtype and IFNAR1−/− glial cultures were treated with 10 μM Aβ1-42 for 24–96 h and analyzed by Q-PCR.
Significantly, expression of the iNOS pro-inflammatory marker was elevated in wildtype but not IFNAR1−/− glial cultures in response to Aβ1-42 (24 h: Wildtype: 5.4 ± 2.8-fold vs. IFNAR1−/−: 1.1 ± 0.3-fold, p = 0.0195; 48 h: Wildtype: 5.9 ± 2.3-fold vs. IFNAR1−/−: 0.6 ± 0.06-fold, p = 0.0032, n = 4–5 per genotype, Fig. 7a). Transcript levels of the CD11b pro-inflammatory marker were also elevated in Aβ1-42-treated wildtype cultures but not when IFNAR1 was absent (72 h: Wildtype: 3.6 ± 0.9-fold vs. IFNAR1−/−: 0.7 ± 0.2-fold, p = 0.0274; 96 h: Wildtype: 4.1 ± 1.2-fold vs. IFNAR1−/−: 0.8 ± 0.2-fold, p = 0.0083, n = 4–5 per genotype, Fig. 7a). Expression levels of the CD32 pro-inflammatory marker were also reduced in IFNAR1−/− glial cultures when compared to wildtype counterparts upon Aβ1-42 insult (96 h: Wildtype: 4.6 ± 1.4-fold vs. IFNAR1−/−: 1.4 ± 0.2-fold, p = 0.0054, n = 4–5 per genotype, Fig. 7a).
Analysis of the ARG1 anti-inflammatory marker revealed elevated expression levels in Aβ1-42-treated IFNAR1−/− glia but not wildtype cultures (72 h: Wildtype: 0.8 ± 0.5-fold vs. IFNAR1−/−: 2.9 ± 0.9-fold, p = 0.0252; 96 h: Wildtype: 1.3 ± 0.7-fold vs. IFNAR1−/−: 3.5 ± 0.5-fold, p = 0.0163, n = 4–5 per genotype, Fig. 7b). CCL22 anti-inflammatory marker expression levels were also elevated in Aβ1-42-treated IFNAR1−/− glia but not wildtype cultures (24 h: Wildtype: 1.0 ± 0.3-fold vs. IFNAR1−/−: 2.5 ± 0.5-fold, p = 0.0089, n = 4–5 per genotype, Fig. 7b). Expression levels of the anti-inflammatory markers YM1 and TGF-β remained constant across all time points and between genotypes (n = 4–5 per genotype, Fig. 7b). Expression levels of the CD206 anti-inflammatory marker were elevated in response to Aβ1-42 treatment but no difference between culture genotype was detected (n = 4–5 per genotype, Fig. 7b). Expression levels of the TGFβ anti-inflammatory marker remained constant across all time points and between genotypes (n = 4–5 per genotype, Fig. 7b). Collectively these data suggest that wildtype glia adopt a mixed inflammatory polarization phenotype in response to amyloid insult. Removal of IFNAR1 shifts this mixed population towards a predominantly anti-inflammatory polarization state.

Conditioned media from Aβ1-42-treated IFNAR1−/− primary glia is less toxic to primary cultured neurons than wildtype media

To investigate the contribution of the glial polarized inflammatory response to Aβ1-42 on neuronal viability, primary wildtype and IFNAR1−/− mixed glial cultures were treated with 10 μM Aβ1-42 for 24–48 h and media was collected. Primary wildtype neuronal cultures were then supplemented with this media for 48 h and an MTS assay was performed to assess cellular viability. Significantly, treatment of neurons with wildtype glial conditioned media induced severe cytotoxicity that was attenuated when the same neurons were supplemented with IFNAR1−/− glial conditioned media (24 h media: Wildtype: 28.9 ± 1.2 % vs. IFNAR1−/−: 77.8 ± 5.7 %, p = 0.0003; 48 h media: Wildtype: 18.4 ± 1.9 % vs. IFNAR1−/−: 85.1 ± 7.1 %, p = 0.0001, n = 3 individual neuronal and glial cultures per genotype, Fig. 8). Both genotypes showed equal susceptibility to staurosporine-induced apoptosis. This data implies that the reduced Aβ1-42-induced pro-inflammatory cytokine burden and anti-inflammatory activity identified in IFNAR1−/− glia is protective to neurons in vitro.

Discussion

The precise mechanism of how Aβ drives neurotoxicity and exacerbation of AD remains largely unknown. Neuro-inflammation has been routinely implicated in AD and is gaining credence as a major facilitator of disease progression [25, 41, 46, 47]. Type-1 IFNs are master regulators of the innate immune response [33] regulating IL-1β, IL-6 and TNFα cytokine secretion that remain up-regulated in AD [42, 43]. The present study was designed to test the hypothesis that type-1 IFN signalling influences neuro-inflammation and subsequent pathology in the APPSWE/PS1ΔE9 mouse model of AD. To address this hypothesis we generated APPSWE/PS1ΔE9 x IFNAR1−/− mice lacking type-1 IFN signaling. We identified that these mice were protected from spatial learning and memory deficits demonstrated by APPSWE/PS1ΔE9 mice. Interestingly, this phenotypic rescue did not correlate with alterations in Aβ plaque burden and only modest reductions in soluble cortical Aβ monomers were detected. Additionally, removal IFNAR1 in the APPSWE/PS1ΔE9 mouse promoted cortical astrocyte reactivity, decreased total microgliosis, and conferred a largely anti-inflammatory glial phenotype. These findings were corroborated with IFNAR1−/− glial cultures initiating a predominantly anti-inflammatory response to in vitro Aβ1-42 insult (Fig. 9).
Our observation that removal of IFNAR1 in APPSWE/PS1ΔE9 mice alters many aspects of the neuro-inflammatory response, improves performance in the MWM behavioural test paradigm, but does not significantly alter amyloid pathology is notable. Whilst it is clear that amelioration of amyloidosis in the majority of preclinical AD models results cognitive benefit, we speculate that alleviating the pro-inflammatory burden on the CNS alone is sufficient to rescue at least some of the cognitive impairment demonstrated in these models. We demonstrate that IFNα and IRF7 are up-regulated in APPSWE/PS1ΔE9 mice and this expression is attenuated upon removal of IFNAR1. Crucially, IRF7 is considered a central mediator of the deleterious type-1 IFN response on neurogenesis and cognition in old mice that lack amyloid deposition; a phenotype rescued upon anti-IFNAR1 monoclonal antibody treatment [3]. Thus modulation of the type-1 IFN signalling system and subsequent neuro-inflammatory responses may be sufficient in providing cognitive benefit irrespective of the clearance of Aβ. However, we cannot rule out the modest, albeit significant, reduction in Aβ monomer levels observed in the APPSWE/PS1ΔE9 x IFNAR1−/− mice and its potential effect on cognition. Indeed, targeted removal of soluble Aβ production in aged tetracycline-inducible APPSWE (Tg2576) mice reverts spatial learning and memory impairments in the MWM without affecting plaque burden [21]. Thus further studies involving mass spectrometry profiles and electron microscopy of Aβ species produced in APPSWE/PS1ΔE9 x IFNAR1−/− may provide insight on the mechanisms by which type-1 IFN signalling potentially influences Aβ oligomerization and cognition.
The identification of attenuated plaque-localised microgliosis, a predominant anti-inflammatory glial phenotype combined with enhanced plaque-localised astrocytic reactivity in APPSWE/PS1ΔE9 x IFNAR1−/− mice is also of interest. We confirm downregulated expression of pro-inflammatory (iNOS, CD11b and CD33) and up-regulations of anti-inflammatory glial phenotypic markers (TGFβ, YM1, ARG1 and TREM2) upon removal of IFNAR1 in APPSWE/PS1ΔE9 mice. Many studies suggest that this glial phenotypic shift results in enhanced Aβ phagocytosis and clearance, yet we do not observe this. One possible explanation is that the anti-inflammatory microglial activity may be counteracted by enhanced astrocyte reactivity and elevated IL-1β secretion, known to promote amyloidosis in APPSWE/PS1ΔE9 mice [26]. Indeed type-1 IFNs are pleiotropic in nature and induce cell-type specific functions [49]. Whilst this study focuses on the pro-inflammatory role of these cytokines it is equally feasible that type-1 IFNs are also exhibiting beneficial anti-inflammatory activity in specific cell types. There are currently 14 known IFNα subtypes produced in mice, 13 in humans and a singular IFNβ isoform, that in the majority of cases require IFNAR1 for signalling. Thus the mixed inflammatory phenotype we observe in our global IFNAR1 knockout approach in APPSWE/PS1ΔE9 mice is likely due to signalling elimination of these type-1 IFN subtypes and their pleiotropic effects in multiple cell types. Further studies identifying specific type-1 IFN subtypes and their contribution to neuro-inflammatory cascades and potential impact on amyloidosis will be beneficial in understanding the progression of AD.
Stimulation of primary mixed glial cultures lacking IFNAR1 with Aβ1-42 results in a predominantly anti-inflammatory response as observed in vivo. We demonstrate that the IFNAR1−/− glial response to Aβ1-42 challenge is neuro-protective compared to the wildtype pro-inflammatory response in our conditioned media paradigm. We propose two alternative explanations for the protection observed in this assay: 1) IFNAR1−/− glia are more effective at removing Aβ1-42 from the media than wildtype cultures, resulting in less Aβ1-42 transfer to neuronal cultures and subsequent reduction in neuro-toxicity. 2) Aβ1-42 insult triggers a reduced pro-inflammatory response from IFNAR1−/− glia compared to wildtype cultures, meaning that cytokine concentrations are reduced when transferred onto neurons resulting in neuroprotection. Indeed, the phenotype observed may be resultant from a combination of these two explanations and warrants further experimentation to explore this neuro-protective mechanism.
Whilst the use of a global IFNAR1−/− mouse remains a strength of the current study, enabling conclusions based on the effect of complete removal of type-1 IFN signaling, this also remains a limitation as the central and peripheral cellular contribution to neuro-inflammation in APPSWE/PS1ΔE9 mice cannot be separated. Indeed, peripheral T-regulatory FoxP3+ve cells appear to breach the CSF-blood brain barrier and their presence within the CNS impacts AD pathology [4]. Considering the important role of type-1 IFN signaling in T-cell activity [16], analyzing these cell types and other peripherally invading immune cells will be crucial in further deciphering the role of type-1 IFN signaling in progression of AD. In addition, it will be important to decipher the impact of reduced endogenous murine APP levels in APPSWE/PS1ΔE9 x IFNAR1−/− mice, although endogenous Aβ production appears not to influence pathology in mice carrying both mutant APP and PS1 alleles [39].

Conclusion

The mechanisms by which neuro-neuroinflammation contributes to AD exacerbation and progression is highly complex and far from being fully understood. We provide evidence that removal of type-1 IFN signalling in the APPSWE/PS1ΔE9 mouse model of AD confers a predominantly anti-inflammatory glial response and protects from cognitive decline. However our finding that this phenotype does not correlate with alterations in amyloid deposition and only a modest reduction in Aβ monomer levels requires further investigation. Deciphering the exact contribution of type-1 IFN isoforms and cell types involved in the neuro-inflammatory response will benefit our understanding of AD pathogenesis and enhance our ability to target type-1 IFN signalling in numerous neuro-inflammatory disorders.

Abbreviations

Aβ, amyloid-beta; AD, Alzheimer’s disease; APP, amyloid precursor protein; CTF, c-terminal fragment; ELISA, enzyme-linked immunosorbent assay; GFAP, glial fibrillary acidic protein; IBA-1, ionized calcium-binder adapter molecule-1; IFN, interferon; IFNAR1, type-1 interferon alpha receptor; IL, interleukin; IRF, interferon regulatory factor; JAK, janus-associated kinase; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; MWM, Morris water maze; NFkB, nuclear factor kappa-B; NLRP, nod-like receptor; PS1, presenilin-1; Q-PCR, quantitative-polymerase chain reaction; Stat, signal transducer and activator of transcription; TNF, tumor necrosis factor

Acknowledgments

The authors would like to acknowledge A/Prof. Paul A. Adlard (Synaptic Neurobiology Laboratory, Division of Mental Health, The Florey Institute of Neuroscience and Mental Health Parkville, VIC, Australia) for his kind donation of the WO-2 monoclonal antibody and advice concerning the APPSWE/PS1ΔE9 mouse model. The authors thank Mr Bevan Main for technical assistance. The authors thank Prof. Anthony J. Hannan, Mr. Jake Rogers and Mr. Ariel Zeleznikow-Johnston (The Florey Institute of Neuroscience and Mental Health, The University of Melbourne, Parkville, Australia) for expert advice on rodent behavior and behavioral testing paradigms.

Funding

This study was supported by grants from the National Health and Medical Research Council (NHMRC) of Australia to P.J.C and J.M.T. P.J.C is an Australian Research Council (ARC) Future Fellow. M.R.M holds an Alzheimer’s Australia Dementia Research Fund (AADRF) postgraduate scholarship.

Availability of data and materials

All data acquired from this study are presented in the manuscript or available upon request from the corresponding authors. All materials used in this study are available upon request from the corresponding authors.

Authors’ contributions

MRM, JMT and PJC conceived the study. MRM, ZM, MZ, KMB, and SRS conducted the experiments. MRM, ZM, NCJ, SRS, JMT and PJC calculated the data and interpreted the results. MRM, JMT and PJC wrote the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare they have no competing interests.

Ethics approval

All animal procedures were performed in accordance with the University of Melbourne animal care committee’s regulations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
insite
INHALT
download
DOWNLOAD
print
DRUCKEN
Anhänge

Additional files

Additional file 1: Figure S1. Generation and confirmation of the APPSWE/PS1ΔE9 x IFNAR1−/− mouse. A) To generate a colony of C57BL/6 APPSWE/PS1ΔE9 x IFNAR1−/− mice with appropriate IFNAR1−/− littermate controls, heterozygous APPSWE/PS1ΔE9 mice were bred to mice homozygous for the IFNAR1 gene disruption (neomycin insert; IFNAR1−/−). The subsequent litters were termed F1 progeny and were expected to yield mice heterozygous for both the APPSWE/PS1ΔE9 mutation and IFNAR1-neoE5 allele (25 % male and 25 % female according to Mendelian inheritance). Upon genetic confirmation, APPSWE/PS1ΔE9 (het) x IFNAR1+/− mice were then interbred to generate the first APPSWE/PS1ΔE9 x IFNAR1−/− mice from F2 progeny (6.25 % male and 6.25 % female according to Mendelian inheritance). APPSWE/PS1ΔE9 (het) x IFNAR1−/− mice were then interbred to generate F3 progeny consisting of APPSWE/PS1ΔE9 x IFNAR1−/− (75 %) and IFNAR1−/− (25 %) littermates. B) Genotyping results for the initial progeny containing APPSWE/PS1ΔE9 x IFNAR1−/− and littermate IFNAR1−/− mice is displayed. Genotyping PCR was performed using a combined APPSWE/PS1ΔE9 and IFNAR1−/−. For each mouse, genotyping for APPSWE, PS1ΔE9 and IFNAR1 expression was performed in separate reactions with internal control (IC) amplification (APPSWE reactions only). The expected band sizes were as follows: APPSWE: 377 bp, PS1ΔE9: 608 bp, wildtype IFNAR1: 351 bp, IFNAR1-neomycin (IFNAR1−/−): 985 bp and IC: 324 bp. APP positive bands in lanes 2, 8 and 12 are comprised of both APPSWE and IC bands as indicated in the fig. C) Immunoblotting of Tris–HCl soluble cortical brain extracts, using mAb WO-2, revealed effective APP overexpression in APPSWE/PS1ΔE9 x IFNAR1−/− mice that was indistinguishable from levels in APPSWE/PS1ΔE9 mice. (TIF 6948 kb)
Literatur
1.
Zurück zum Zitat Adlard PA, Cherny RA, Finkelstein DI, Gautier E, Robb E, Cortes M, Volitakis I, Liu X, Smith JP, Perez K et al. Rapid restoration of cognition in Alzheimer's transgenic mice with 8-hydroxy quinoline analogs is associated with decreased interstitial Abeta. Neuron. 2008;59:43–55. doi:10.1016/j.neuron.2008.06.018.CrossRefPubMed Adlard PA, Cherny RA, Finkelstein DI, Gautier E, Robb E, Cortes M, Volitakis I, Liu X, Smith JP, Perez K et al. Rapid restoration of cognition in Alzheimer's transgenic mice with 8-hydroxy quinoline analogs is associated with decreased interstitial Abeta. Neuron. 2008;59:43–55. doi:10.​1016/​j.​neuron.​2008.​06.​018.CrossRefPubMed
2.
Zurück zum Zitat Barnham KJ, Ciccotosto GD, Tickler AK, Ali FE, Smith DG, Williamson NA, Lam YH, Carrington D, Tew D, Kocak G et al. Neurotoxic, redox-competent Alzheimer's beta-amyloid is released from lipid membrane by methionine oxidation. J Biol Chem. 2003;278:42959–65. doi:10.1074/jbc.M305494200M305494200.CrossRefPubMed Barnham KJ, Ciccotosto GD, Tickler AK, Ali FE, Smith DG, Williamson NA, Lam YH, Carrington D, Tew D, Kocak G et al. Neurotoxic, redox-competent Alzheimer's beta-amyloid is released from lipid membrane by methionine oxidation. J Biol Chem. 2003;278:42959–65. doi:10.​1074/​jbc.​M305494200M30549​4200.CrossRefPubMed
3.
Zurück zum Zitat Baruch K, Deczkowska A, David E, Castellano JM, Miller O, Kertser A, Berkutzki T, Barnett-Itzhaki Z, Bezalel D, Wyss-Coray T et al. Aging. Aging-induced type I interferon response at the choroid plexus negatively affects brain function. Science. 2014;346:89–93. doi:10.1126/science.1252945.CrossRefPubMedPubMedCentral Baruch K, Deczkowska A, David E, Castellano JM, Miller O, Kertser A, Berkutzki T, Barnett-Itzhaki Z, Bezalel D, Wyss-Coray T et al. Aging. Aging-induced type I interferon response at the choroid plexus negatively affects brain function. Science. 2014;346:89–93. doi:10.​1126/​science.​1252945.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Baruch K, Rosenzweig N, Kertser A, Deczkowska A, Sharif AM, Spinrad A, Tsitsou-Kampeli A, Sarel A, Cahalon L, Schwartz M. Breaking immune tolerance by targeting Foxp3(+) regulatory T cells mitigates Alzheimer's disease pathology. Nat Commun. 2015;6:7967. doi:10.1038/ncomms8967.CrossRefPubMedPubMedCentral Baruch K, Rosenzweig N, Kertser A, Deczkowska A, Sharif AM, Spinrad A, Tsitsou-Kampeli A, Sarel A, Cahalon L, Schwartz M. Breaking immune tolerance by targeting Foxp3(+) regulatory T cells mitigates Alzheimer's disease pathology. Nat Commun. 2015;6:7967. doi:10.​1038/​ncomms8967.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54.CrossRefPubMed Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54.CrossRefPubMed
9.
Zurück zum Zitat Buttke TM, McCubrey JA, Owen TC. Use of an aqueous soluble tetrazolium/formazan assay to measure viability and proliferation of lymphokine-dependent cell lines. J Immunol Methods. 1993;157:233–40.CrossRefPubMed Buttke TM, McCubrey JA, Owen TC. Use of an aqueous soluble tetrazolium/formazan assay to measure viability and proliferation of lymphokine-dependent cell lines. J Immunol Methods. 1993;157:233–40.CrossRefPubMed
12.
Zurück zum Zitat Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques. 1993;15(532–534):536–7. Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques. 1993;15(532–534):536–7.
14.
17.
Zurück zum Zitat Crow YJ, Hayward BE, Parmar R, Robins P, Leitch A, Ali M, Black DN, van Bokhoven H, Brunner HG, Hamel BC et al. Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutieres syndrome at the AGS1 locus. Nat Genet. 2006;38:917–20. doi:10.1038/ng1845.CrossRefPubMed Crow YJ, Hayward BE, Parmar R, Robins P, Leitch A, Ali M, Black DN, van Bokhoven H, Brunner HG, Hamel BC et al. Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutieres syndrome at the AGS1 locus. Nat Genet. 2006;38:917–20. doi:10.​1038/​ng1845.CrossRefPubMed
18.
Zurück zum Zitat Crow YJ, Leitch A, Hayward BE, Garner A, Parmar R, Griffith E, Ali M, Semple C, Aicardi J, Babul-Hirji R et al. Mutations in genes encoding ribonuclease H2 subunits cause Aicardi-Goutieres syndrome and mimic congenital viral brain infection. Nat Genet. 2006;38:910–6. doi:10.1038/ng1842.CrossRefPubMed Crow YJ, Leitch A, Hayward BE, Garner A, Parmar R, Griffith E, Ali M, Semple C, Aicardi J, Babul-Hirji R et al. Mutations in genes encoding ribonuclease H2 subunits cause Aicardi-Goutieres syndrome and mimic congenital viral brain infection. Nat Genet. 2006;38:910–6. doi:10.​1038/​ng1842.CrossRefPubMed
22.
Zurück zum Zitat Grundke-Iqbal I, Iqbal K, Tung YC, Quinlan M, Wisniewski HM, Binder LI. Abnormal phosphorylation of the microtubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology. Proc Natl Acad Sci U S A. 1986;83:4913–7.CrossRefPubMedPubMedCentral Grundke-Iqbal I, Iqbal K, Tung YC, Quinlan M, Wisniewski HM, Binder LI. Abnormal phosphorylation of the microtubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology. Proc Natl Acad Sci U S A. 1986;83:4913–7.CrossRefPubMedPubMedCentral
25.
26.
Zurück zum Zitat Heneka MT, Kummer MP, Stutz A, Delekate A, Schwartz S, Vieira-Saecker A, Griep A, Axt D, Remus A, Tzeng TC et al. NLRP3 is activated in Alzheimer's disease and contributes to pathology in APP/PS1 mice. Nature. 2013;493:674–8. doi:10.1038/nature11729.CrossRefPubMed Heneka MT, Kummer MP, Stutz A, Delekate A, Schwartz S, Vieira-Saecker A, Griep A, Axt D, Remus A, Tzeng TC et al. NLRP3 is activated in Alzheimer's disease and contributes to pathology in APP/PS1 mice. Nature. 2013;493:674–8. doi:10.​1038/​nature11729.CrossRefPubMed
27.
Zurück zum Zitat Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, Shimada N, Ohba Y, Takaoka A, Yoshida N et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature. 2005;434:772–7.CrossRefPubMed Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, Shimada N, Ohba Y, Takaoka A, Yoshida N et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature. 2005;434:772–7.CrossRefPubMed
28.
Zurück zum Zitat Hwang SY, Hertzog PJ, Holland KA, Sumarsono SH, Tymms MJ, Hamilton JA, Whitty G, Bertoncello I, Kola I. A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses. Proc Natl Acad Sci U S A. 1995;92:11284–8.CrossRefPubMedPubMedCentral Hwang SY, Hertzog PJ, Holland KA, Sumarsono SH, Tymms MJ, Hamilton JA, Whitty G, Bertoncello I, Kola I. A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses. Proc Natl Acad Sci U S A. 1995;92:11284–8.CrossRefPubMedPubMedCentral
30.
Zurück zum Zitat Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL et al. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet. 2004;13:159–70. doi:10.1093/hmg/ddh019.CrossRefPubMed Jankowsky JL, Fadale DJ, Anderson J, Xu GM, Gonzales V, Jenkins NA, Copeland NG, Lee MK, Younkin LH, Wagner SL et al. Mutant presenilins specifically elevate the levels of the 42 residue beta-amyloid peptide in vivo: evidence for augmentation of a 42-specific gamma secretase. Hum Mol Genet. 2004;13:159–70. doi:10.​1093/​hmg/​ddh019.CrossRefPubMed
32.
Zurück zum Zitat Karve IP, Zhang M, Habgood M, Frugier T, Brody KM, Sashindranath M, Ek CJ, Chappaz S, Kile BT, Wright D et al. Ablation of Type-1 IFN signaling in hematopoietic cells confers protection following traumatic brain injury. eNeuro. 2016;3:0128–15. doi:10.1523/ENEURO.0128-15.2016.CrossRef Karve IP, Zhang M, Habgood M, Frugier T, Brody KM, Sashindranath M, Ek CJ, Chappaz S, Kile BT, Wright D et al. Ablation of Type-1 IFN signaling in hematopoietic cells confers protection following traumatic brain injury. eNeuro. 2016;3:0128–15. doi:10.​1523/​ENEURO.​0128-15.​2016.CrossRef
35.
Zurück zum Zitat Liddell JR, Dringen R, Crack PJ, Robinson SR. Glutathione peroxidase 1 and a high cellular glutathione concentration are essential for effective organic hydroperoxide detoxification in astrocytes. Glia. 2006;54:873–9. doi:10.1002/glia.20433.CrossRefPubMed Liddell JR, Dringen R, Crack PJ, Robinson SR. Glutathione peroxidase 1 and a high cellular glutathione concentration are essential for effective organic hydroperoxide detoxification in astrocytes. Glia. 2006;54:873–9. doi:10.​1002/​glia.​20433.CrossRefPubMed
37.
Zurück zum Zitat Luth HJ, Munch G, Arendt T. Aberrant expression of NOS isoforms in Alzheimer's disease is structurally related to nitrotyrosine formation. Brain Res. 2002;953:135–43.CrossRefPubMed Luth HJ, Munch G, Arendt T. Aberrant expression of NOS isoforms in Alzheimer's disease is structurally related to nitrotyrosine formation. Brain Res. 2002;953:135–43.CrossRefPubMed
38.
Zurück zum Zitat Luth HJ, Ogunlade V, Kuhla B, Kientsch-Engel R, Stahl P, Webster J, Arendt T, Munch G. Age- and stage-dependent accumulation of advanced glycation end products in intracellular deposits in normal and Alzheimer's disease brains. Cereb Cortex. 2005;15:211–20. doi:10.1093/cercor/bhh123.CrossRefPubMed Luth HJ, Ogunlade V, Kuhla B, Kientsch-Engel R, Stahl P, Webster J, Arendt T, Munch G. Age- and stage-dependent accumulation of advanced glycation end products in intracellular deposits in normal and Alzheimer's disease brains. Cereb Cortex. 2005;15:211–20. doi:10.​1093/​cercor/​bhh123.CrossRefPubMed
42.
43.
Zurück zum Zitat McGeer PL, McGeer EG, Yasojima K. Alzheimer disease and neuroinflammation. J Neural Transm Suppl. 2000;59:53–7.PubMed McGeer PL, McGeer EG, Yasojima K. Alzheimer disease and neuroinflammation. J Neural Transm Suppl. 2000;59:53–7.PubMed
45.
47.
Zurück zum Zitat Morris GP, Clark IA, Vissel B. Inconsistencies and controversies surrounding the amyloid hypothesis of Alzheimer's disease. Acta Neuropathol Comm. 2014;2:135. doi:10.1186/s40478-014-0135-5. Morris GP, Clark IA, Vissel B. Inconsistencies and controversies surrounding the amyloid hypothesis of Alzheimer's disease. Acta Neuropathol Comm. 2014;2:135. doi:10.​1186/​s40478-014-0135-5.
48.
Zurück zum Zitat Munch G, Schinzel R, Loske C, Wong A, Durany N, Li JJ, Vlassara H, Smith MA, Perry G, Riederer P. Alzheimer's disease--synergistic effects of glucose deficit, oxidative stress and advanced glycation endproducts. J Neural Transm. 1998;105:439–61.CrossRefPubMed Munch G, Schinzel R, Loske C, Wong A, Durany N, Li JJ, Vlassara H, Smith MA, Perry G, Riederer P. Alzheimer's disease--synergistic effects of glucose deficit, oxidative stress and advanced glycation endproducts. J Neural Transm. 1998;105:439–61.CrossRefPubMed
51.
Zurück zum Zitat Owens T, Khorooshi R, Wlodarczyk A, Asgari N. Interferons in the central nervous system: a few instruments play many tunes. Glia. 2014;62:339–55.CrossRefPubMed Owens T, Khorooshi R, Wlodarczyk A, Asgari N. Interferons in the central nervous system: a few instruments play many tunes. Glia. 2014;62:339–55.CrossRefPubMed
53.
Zurück zum Zitat Prokop S, Miller KR, Heppner FL. Microglia actions in Alzheimer's disease. Acta Neuropathol. 2013;126:461–77.CrossRefPubMed Prokop S, Miller KR, Heppner FL. Microglia actions in Alzheimer's disease. Acta Neuropathol. 2013;126:461–77.CrossRefPubMed
54.
Zurück zum Zitat Retz W, Gsell W, Munch G, Rosler M, Riederer P. Free radicals in Alzheimer's disease. J Neural Transm Suppl. 1998;54:221–36.CrossRefPubMed Retz W, Gsell W, Munch G, Rosler M, Riederer P. Free radicals in Alzheimer's disease. J Neural Transm Suppl. 1998;54:221–36.CrossRefPubMed
56.
Zurück zum Zitat Sakaguchi S, Negishi H, Asagiri M, Nakajima C, Mizutani T, Takaoka A, Honda K, Taniguchi T. Essential role of IRF-3 in lipopolysaccharide-induced interferon-beta gene expression and endotoxin shock. Biochem Biophys Res Commun. 2003;306:860–6.CrossRefPubMed Sakaguchi S, Negishi H, Asagiri M, Nakajima C, Mizutani T, Takaoka A, Honda K, Taniguchi T. Essential role of IRF-3 in lipopolysaccharide-induced interferon-beta gene expression and endotoxin shock. Biochem Biophys Res Commun. 2003;306:860–6.CrossRefPubMed
57.
Zurück zum Zitat Salminen A, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Inflammation in Alzheimer's disease: amyloid-beta oligomers trigger innate immunity defence via pattern recognition receptors. Prog Neurobiol. 2009;87:181–94.CrossRefPubMed Salminen A, Ojala J, Kauppinen A, Kaarniranta K, Suuronen T. Inflammation in Alzheimer's disease: amyloid-beta oligomers trigger innate immunity defence via pattern recognition receptors. Prog Neurobiol. 2009;87:181–94.CrossRefPubMed
59.
Zurück zum Zitat Sastre M, Dewachter I, Landreth GE, Willson TM, Klockgether T, van Leuven F, Heneka MT. Nonsteroidal anti-inflammatory drugs and peroxisome proliferator-activated receptor-gamma agonists modulate immunostimulated processing of amyloid precursor protein through regulation of beta-secretase. J Neurosci. 2003;23:9796–804.PubMed Sastre M, Dewachter I, Landreth GE, Willson TM, Klockgether T, van Leuven F, Heneka MT. Nonsteroidal anti-inflammatory drugs and peroxisome proliferator-activated receptor-gamma agonists modulate immunostimulated processing of amyloid precursor protein through regulation of beta-secretase. J Neurosci. 2003;23:9796–804.PubMed
60.
Zurück zum Zitat Selkoe DJ. Alzheimer's disease results from the cerebral accumulation and cytotoxicity of amyloid beta-protein. J Alzheimers Dis. 2001;3:75–80.PubMed Selkoe DJ. Alzheimer's disease results from the cerebral accumulation and cytotoxicity of amyloid beta-protein. J Alzheimers Dis. 2001;3:75–80.PubMed
61.
Zurück zum Zitat Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA et al. A family of cytokine-inducible inhibitors of signalling. Nature. 1997;387:917–21. doi:10.1038/43206.CrossRefPubMed Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA et al. A family of cytokine-inducible inhibitors of signalling. Nature. 1997;387:917–21. doi:10.​1038/​43206.CrossRefPubMed
65.
Zurück zum Zitat Tenoever BR, Ng SL, Chua MA, McWhirter SM, Garcia-Sastre A, Maniatis T. Multiple functions of the IKK-related kinase IKKepsilon in interferon-mediated antiviral immunity. Science. 2007;315:1274–8. doi:10.1126/science.1136567.CrossRefPubMed Tenoever BR, Ng SL, Chua MA, McWhirter SM, Garcia-Sastre A, Maniatis T. Multiple functions of the IKK-related kinase IKKepsilon in interferon-mediated antiviral immunity. Science. 2007;315:1274–8. doi:10.​1126/​science.​1136567.CrossRefPubMed
66.
Zurück zum Zitat Vom Berg J, Prokop S, Miller KR, Obst J, Kalin RE, Lopategui-Cabezas I, Wegner A, Mair F, Schipke CG, Peters O et al. Inhibition of IL-12/IL-23 signaling reduces Alzheimer's disease-like pathology and cognitive decline. Nat Med. 2012;18:1812–9. doi:10.1038/nm.2965.CrossRefPubMed Vom Berg J, Prokop S, Miller KR, Obst J, Kalin RE, Lopategui-Cabezas I, Wegner A, Mair F, Schipke CG, Peters O et al. Inhibition of IL-12/IL-23 signaling reduces Alzheimer's disease-like pathology and cognitive decline. Nat Med. 2012;18:1812–9. doi:10.​1038/​nm.​2965.CrossRefPubMed
67.
Zurück zum Zitat Weggen S, Eriksen JL, Das P, Sagi SA, Wang R, Pietrzik CU, Findlay KA, Smith TE, Murphy MP, Bulter T et al. A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature. 2001;414:212–6. doi:10.1038/35102591.CrossRefPubMed Weggen S, Eriksen JL, Das P, Sagi SA, Wang R, Pietrzik CU, Findlay KA, Smith TE, Murphy MP, Bulter T et al. A subset of NSAIDs lower amyloidogenic Abeta42 independently of cyclooxygenase activity. Nature. 2001;414:212–6. doi:10.​1038/​35102591.CrossRefPubMed
68.
Zurück zum Zitat Wun KS, Miles LA, Crespi GA, Wycherley K, Ascher DB, Barnham KJ, Cappai R, Beyreuther K, Masters CL, Parker MW et al. Crystallization and preliminary X-ray diffraction analysis of the Fab fragment of WO2, an antibody specific for the Abeta peptides associated with Alzheimer's disease. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2008;64:438–41. doi:10.1107/S1744309108011718.CrossRefPubMedPubMedCentral Wun KS, Miles LA, Crespi GA, Wycherley K, Ascher DB, Barnham KJ, Cappai R, Beyreuther K, Masters CL, Parker MW et al. Crystallization and preliminary X-ray diffraction analysis of the Fab fragment of WO2, an antibody specific for the Abeta peptides associated with Alzheimer's disease. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2008;64:438–41. doi:10.​1107/​S174430910801171​8.CrossRefPubMedPubMedCentral
Metadaten
Titel
Deletion of the type-1 interferon receptor in APPSWE/PS1ΔE9 mice preserves cognitive function and alters glial phenotype
verfasst von
Myles R. Minter
Zachery Moore
Moses Zhang
Kate M. Brody
Nigel C. Jones
Sandy R. Shultz
Juliet M. Taylor
Peter J. Crack
Publikationsdatum
01.12.2016
Verlag
BioMed Central
Erschienen in
Acta Neuropathologica Communications / Ausgabe 1/2016
Elektronische ISSN: 2051-5960
DOI
https://doi.org/10.1186/s40478-016-0341-4

Weitere Artikel der Ausgabe 1/2016

Acta Neuropathologica Communications 1/2016 Zur Ausgabe

Leitlinien kompakt für die Neurologie

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Hirnblutung unter DOAK und VKA ähnlich bedrohlich

17.05.2024 Direkte orale Antikoagulanzien Nachrichten

Kommt es zu einer nichttraumatischen Hirnblutung, spielt es keine große Rolle, ob die Betroffenen zuvor direkt wirksame orale Antikoagulanzien oder Marcumar bekommen haben: Die Prognose ist ähnlich schlecht.

Thrombektomie auch bei großen Infarkten von Vorteil

16.05.2024 Ischämischer Schlaganfall Nachrichten

Auch ein sehr ausgedehnter ischämischer Schlaganfall scheint an sich kein Grund zu sein, von einer mechanischen Thrombektomie abzusehen. Dafür spricht die LASTE-Studie, an der Patienten und Patientinnen mit einem ASPECTS von maximal 5 beteiligt waren.

Schwindelursache: Massagepistole lässt Otholiten tanzen

14.05.2024 Benigner Lagerungsschwindel Nachrichten

Wenn jüngere Menschen über ständig rezidivierenden Lagerungsschwindel klagen, könnte eine Massagepistole der Auslöser sein. In JAMA Otolaryngology warnt ein Team vor der Anwendung hochpotenter Geräte im Bereich des Nackens.

Schützt Olivenöl vor dem Tod durch Demenz?

10.05.2024 Morbus Alzheimer Nachrichten

Konsumieren Menschen täglich 7 Gramm Olivenöl, ist ihr Risiko, an einer Demenz zu sterben, um mehr als ein Viertel reduziert – und dies weitgehend unabhängig von ihrer sonstigen Ernährung. Dafür sprechen Auswertungen zweier großer US-Studien.

Update Neurologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.