Skip to main content
Erschienen in: BMC Neurology 1/2006

Open Access 01.12.2006 | Research article

Analysis of IFT74as a candidate gene for chromosome 9p-linked ALS-FTD

verfasst von: Parastoo Momeni, Jennifer Schymick, Shushant Jain, Mark R Cookson, Nigel J Cairns, Elisa Greggio, Matthew J Greenway, Stephen Berger, Stuart Pickering-Brown, Adriano Chiò, Hon Chung Fung, David M Holtzman, Edward D Huey, Eric M Wassermann, Jennifer Adamson, Michael L Hutton, Ekaterina Rogaeva, Peter St George-Hyslop, Jeffrey D Rothstein, Orla Hardiman, Jordan Grafman, Andrew Singleton, John Hardy, Bryan J Traynor

Erschienen in: BMC Neurology | Ausgabe 1/2006

Abstract

Background

A new locus for amyotrophic lateral sclerosis – frontotemporal dementia (ALS-FTD) has recently been ascribed to chromosome 9p.

Methods

We identified chromosome 9p segregating haplotypes within two families with ALS-FTD (F476 and F2) and undertook mutational screening of candidate genes within this locus.

Results

Candidate gene sequencing at this locus revealed the presence of a disease segregating stop mutation (Q342X) in the intraflagellar transport 74 (IFT74) gene in family 476 (F476), but no mutation was detected within IFT74 in family 2 (F2). While neither family was sufficiently informative to definitively implicate or exclude IFT74 mutations as a cause of chromosome 9-linked ALS-FTD, the nature of the mutation observed within F476 (predicted to truncate the protein by 258 amino acids) led us to sequence the open reading frame of this gene in a large number of ALS and FTD cases (n = 420). An additional sequence variant (G58D) was found in a case of sporadic semantic dementia. I55L sequence variants were found in three other unrelated affected individuals, but this was also found in a single individual among 800 Human Diversity Gene Panel samples.

Conclusion

Confirmation of the pathogenicity of IFT74 sequence variants will require screening of other chromosome 9p-linked families.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1471-2377-6-44) contains supplementary material, which is available to authorized users.
Parastoo Momeni, Jennifer Schymick, Shushant Jain contributed equally to this work.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

PM, JS and SJ contributed equally to this work. PM, JS, SJ and SB carried out the molecular genetic studies, participated in the sequence alignment and drafted the manuscript. AS, JH and BJT conceived of the study, participated in its design and coordination, performed data analysis and drafted the manuscript. MRC and EG carried out the immunoassays and drafted the manuscript. NJC and DMH performed the autopsy, provided the photomicrographs and participated in writing the manuscript. MJG, SP, AC, HCF, EH, EW, JA, MLH, ER, PS, JDR, OH and JG were involved in ascertaining patients, providing phenotype data, obtained DNA samples and participated in editing the manuscript. All authors read and approved the final manuscript.
Abkürzungen
ALS
amyotrophic lateral sclerosis
FTD
frontotemporal dementia, IFT74, intraflagellar transport 74 homologue
OMIM
online Mendelian inheritance in man
FTLD
frontotemporal lobar degeneration
FTLD-U
FTLD with ubiquitin-positive, tau-negative inclusions
MND
motor neuron disease
NCBI
national center for biotechnology information
SOD1
superoxide dismutase one
MAPT
microtubule-associated protein tau
GRN
granulin
CEPH
Centre d'Etude du Polymorphisme Humain
HGDP
Human Genome Diversity Panel
cDNA
complementary DNA
RACE
Rapid Amplification of cDNA Ends
SDS-PAGE
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
CMG1
capillary morphogenesis protein 1
Refseq
reference sequence
KIF1B
kinesin family member 1B.

Background

Amyotrophic lateral sclerosis (ALS, Online Mendelian Inheritance in Man (OMIM) 105400) is characterized by progressive motor neuron degeneration resulting in paralysis and death, usually from respiratory failure, within 3 to 5 years of symptom onset[1]. ALS is typically sporadic in nature. However, 5–10% of cases are familial, and the identification of causal mutations has provided insight into the disease processes that lead to neurodegeneration [25]. Frontotemporal dementia (FTD, OMIM 600274) is a degenerative disorder of the frontal and anterior temporal lobes [6] and is the second most common cause of dementia accounting for approximately 20% of pre-senile cases [7]. The syndrome is characterized clinically by initial behavioral and psychological disturbances, followed by cognitive decline eventually leading to dementia and death within a median of seven years from symptom onset [8]. There is a family history of dementia in over 40% of FTD cases suggesting genetic components [8].
Clinical and pathological data indicate that ALS and FTD can form a spectrum of disease [9]. Approximately 5% of ALS patients have clinically florid dementia (ALS-FTD) [10] and roughly half of patients with "classical" ALS have subtle frontal and temporal lobe impairment [11]. Many sporadic and familial FTD cases similarly develop clinical symptoms of motor neuron involvement during the course of their illness [12, 8]. Furthermore, ubiquitin inclusions and dystrophic neurites are the hallmark neuropathological findings common to ALS without cognitive impairment, ALS with cognitive impairment, ALS-FTD and "pure" FTD with a greater distribution and load of lesions being associated with cognitive impairment [13].
Recently, linkage of ALS-FTD in Dutch and Scandinavian families with apparently autosomal dominant disease was ascribed to a 9.8 megabase (Mb) region at chromosome 9p13.2–21.3 [14, 15]. This linkage was replicated and additional haplotype information from seven American ALS-FTD kindreds narrowed the 9p locus to a 2.1 Mb region flanked by D9S1678 and D9S2154 containing 14 genes (figure 1) [16]. We identified two families from the United States that were potentially linked to the 9p locus. Using these families, we undertook a methodical assessment of candidate genes in an attempt to identify the underlying genetic lesion responsible for disease.

Methods

Subjects and samples

F476 was a four-generation, 15-member North American ALS-FTD kindred. The proband (figure 2a, III-3) was a 58-year-old male with a seven year history of behavioral FTD symptoms who subsequently developed ALS during the course of his illness. His younger brother (III-4) developed perseveration, lack of insight and dysregulation of social and interpersonal conduct at the age of 52. He later developed motor weakness and remains alive three years after disease onset. An older brother (III-1) began showing poor judgment and inappropriate behavior at 50 years of age. He died twelve years later with severe dementia. Marked frontal and anterior temporal lobe atrophy was detected at post-mortem. Histology revealed the stereotypical features of frontotemporal lobar degenerations (FTLDs): neuronal loss, microvacuolation, and gliosis (figure 3). The frontal lobe was the most severely affected region with focal trancortical neuronal loss. Ubiquitin immunohistochemistry revealed neuronal cytoplasmic inclusions, sparse neuronal intranuclear inclusions, and dystrophic neurites identical to those seen in familial and sporadic cases of FTLD with ubiquitin-positive, tau-negative inclusions (FTLD-U). There were Bunina bodies in the motor neurons of the anterior horns of the cervical spinal cord, but there was no evidence of corticospinal tract degeneration seen in cases of motor neuron disease. This case had additional Alzheimer's disease-type pathology, namely diffuse beta-amyloid plaques in the absence of neuritic plaques or neurofibrillary tangles. Autopsies and neuropathological procedures were performed according to the protocols of the Washington University Alzheimer's Disease Research Center neuropathology Core.
F2 was a three-generation, 16-member North American kindred, in which seven individuals had been diagnosed with ALS-FTD (figure 2b).
Patients with ALS fulfilled the El Escorial criteria for probable or definite ALS and were diagnosed by a consultant neurologist after exclusion of ALS mimic syndromes [17]. Frontotemporal dementia was diagnosed by clinical and neuropsychological criteria. The diagnosis was confirmed by autopsy in one familial ALS-FTD case.

Marker analysis

DNA was extracted by standard procedures after ethically approved, written informed consent was obtained. Ethical approval for collection of DNA and clinical phenotype information was provided by the National Institute of Aging Institutional Review Board, Baltimore, MD (protocol #2003-081). Polymerase chain reaction (PCR) was performed to amplify DNA with markers spaced across the known chromosome 9p21 locus. Markers were selected from the Applied Biosystems Prism Linkage Mapping Set Version 2.5 (ABI, Foster City, CA). Additional makers were chosen based on mapping information publicly available from the UNISTS database at the National Center for Biotechnology Information (NCBI). For allele identification, the PCR products were separated and scored using automated ABI 3100 sequencing equipment.

Sequencing of candidate genes

The 14 genes within the 2.1 Mb region of the 9p locus defined by the Dutch, Scandinavian and North American families[1416] were identified from the NCBI [18] and Ensembl databases [19]. Genomic primer design for all genes was performed using ExonPrimer [20]. Each exon and at least 30 bp of flanking intronic sequence was PCR amplified using primer pairs (available upon request) using whole genome amplified DNA (Repli-G, Qiagen Inc., Valencia, CA) from affected individuals of each family used. PCR amplification was carried out using Qiagen HotStarTaq master mix polymerase, and 10 pmol of both forward and reverse primers per the manufacturer's instructions (Qiagen Inc.). Each product was sequenced using forward and reverse primers with Applied Biosystems BigDye terminator v3.1 sequencing chemistry as per the manufacturer's directions. The resulting reactions were run on an ABI3100 genetic analyzer and analyzed with Sequencher software (version 4.5, GeneCodes Corp., MI). Detected sequence variants were confirmed by repeat PCR amplification and sequencing using original genomic DNA. In addition to these 14 genes, we also sequenced an additional 47 genes in the larger haplotype before the report [16] limiting the linked haplotype became public (Table 1, primers available upon request). Coding and flanking regions of Cu/Zn superoxide dismutase (SOD1), microtubule associated protein tau (MAPT) and progranulin (GRN) genes known to be associated with ALS-FTD[2124], had been sequenced for mutations as previously described[25, 22].
Table 1
Genes in the extended Chromosome 9p ALS-FTD locus* that were excluded as candidate genes by sequencing
Start bp
Symbol
Start bp
Symbol
26,056,673
LOC441390
33,245,026
BAG1
29,814,856
LOC286239
33,255,000
C9orf83
30,378,933
LOC401497
33,278,862
LOC441393
30,678,956
LOC441391
33,280,510
NFX1
30,679,911
LOC442405
33,374,948
AQP7
30,789,463
LOC442406
33,431,162
AQP3
30,811,997
LOC441392
33,451,352
NOL6
31,243,899
LOC138412
33,493,783
LOC441394
32,323,455
LOC392301
33,514,488
ANKRD18B
32,374,650
ACO1
33,570,693
LOC441395
32,445,705
DDX58
33,607,843
TRBV20OR9-2
32,530,543
TOPORS
33,614,223
ANXA2P2
32,543,523
NDUFB6
33,619,141
TRBV21OR9-2
32,619,452
TAF1L
33,623,851
TRBV22OR9-2
32,633,108
LOC389710
33,628,035
TRBV23OR9-2
32,773,497
LOC401498
33,639,129
TRBV24OR9-2
32,935,943
LOC392302
33,652,201
TRBV25OR9-2
32,962,608
APTX
33,665,438
PTENP1
33,009,952
LOC401499
33,672,268
TRBVAOR9-2
33,015,309
DNAJA1
33,685,578
TRBV26OR9-2
33,031,762
LOC401500
33,776,219
TRBV29OR9-2
33,037,169
SMU1
33,785,559
PRSS3
33,100,642
B4GALT1
33,807,565
UBE2R2
33,230,196
SPINK4
  
*as defined by the Dutch and Scandinavian families [14,15]

Mutation assay

The presence of IFT74 sequence variants were assessed in 500 North American control subjects, 9 ALS-FTD cases with a positive family history of ALS-FTD, 11 cases of ALS-FTD without a family history, 164 sporadic FTD cases, 31 cases of familial FTD, 127 Irish cases of ALS and 83 North American cases of ALS (see Table 2 for list of samples). In addition, we used 800 DNA samples from the Centre d'Etude du Polymorphisme Humain (CEPH) Human Genome Diversity Panel (HGDP), a resource of individuals from 51 different world populations. Information for this panel is limited to sex of the individual and population origin [26]. To identify the Q342X sequence variant, a genomic fragment was amplified using the primer pair 5'-TGGAAAAGATATCTAACCTCCCC-3' and 5'-CCCAGGTAGTTGAACAGTCTCTG-3'. The resulting 262 bp fragment was sequenced as described above. The remaining 18 exons of IFT74 were also amplified and sequenced in the patient samples to determine the presence of sequence variants in the rest of the gene (see table 3 for list of primers).
Table 2
Samples in which the IFT74 gene was sequenced
 
Whole gene
Exon 2
Exon 12
NINDS ALS-FTD and FTD samples [32]
32
  
Toronto ALS-FTD and FTD samples [33]
95
  
Irish ALS-FTD and ALS samples [34]
127
  
Johns Hopkins ALS samples
51
  
New York Brain Bank ALS, ALS-FTD and FTD samples
24
  
University of Miami/National Parkinson Foundation ALS samples
7
  
Miscellaneous ALS, ALS-FTD and FTD samples
84
  
North American control samples*
 
450
500
Human Genome Diversity panel [26]
 
800
450
Total
420
1,250
950
*available from the NINDS Neurogenetics Repository at the Coriell Institute for Medical Research, Camden, NJ
Table 3
Primers used to sequence the 19 exons of IFT74
 
Sequence
Product size
Exon 1 Forward
TGAACAAAATTAGCCTTGTAGTGG
395
Exon 1 Reverse
AAAAACTGGGGTGCAGTGG
 
Exon 2 Forward
CTTTGCAGTTTTACAATAAAAGATGT
400
Exon 2 Reverse
CCATAATTCTGATTACATGCCATA
 
Exon 3 Forward
TTGGATTTGCTATTCTGGTGG
172
Exon 3 Reverse
GACAGAAGGTACACAATATTTCGAG
 
Exon 4 Forward
AATTTTGCTTAACTAGAGTTTTCTGG
250
Exon 4 Reverse
TGAACATTACAAACAATATGGATAGC
 
Exon 5 Forward
TTGTAGCTATCCATATTGTTTGTAATG
282
Exon 5 Reverse
CTTGTTGGCTGCATGTTTG
 
Exon 6 Forward
TTTGTTTGTATTTTTGTTTTTAGTTGG
246
Exon 6 Reverse
GCAACTAAGGGAGCTCAAGG
 
Exon 7 Forward
TCATTTAGTTCCTAGCCAAAATAACC
230
Exon 7 Reverse
CAAGGAAATAACTGGATCACAAC
 
Exon 8 Forward
AGTCACACACTGTGGTTGAATG
343
Exon 8 Reverse
TGCTGATGCTGCTGATATTC
 
Exon 9 Forward
TTTCCCAGCTCCCTCCC
304
Exon 9 Reverse
CTAGGATCTTTGTGGGTCCAG
 
Exon 10 Forward
CCCCATTCTTATAAACTGAAACC
324
Exon 10 Reverse
AGCTTTACTACTTGCATTAATATCCC
 
Exon 11 Forward
TTCAAGAAAGAGAGTAGATTTGACAC
301
Exon 11 Reverse
TGCAATGGCTCTTAAACACTC
 
Exon 12 Forward
TGGAAAAGATATCTAACCTCCCC
262
Exon 12 Reverse
CCCAGGTAGTTGAACAGTCTCTG
 
Exon 13 Forward
TGACTAATGGCATAGAGAGAACC
240
Exon 13 Reverse
TATCTGCCCAAAATGAGGTC
 
Exon 14 Forward
GCCTGGCAACAGAGTGAG
357
Exon 14 Reverse
AAGGGAATTGAAAGGAAGCAG
 
Exon 15 Forward
CATCCTTTGACAGTGTTTTCC
297
Exon 15 Reverse
CAATGAGGCTTTAAAATAATCAGAG
 
Exon 16 Forward
GAAATTGGTTATTGAGGGGATG
539
Exon 16 Reverse
TTGCTTTTCTTTAAAACTTTAAGTCAC
 
Exon 17 Forward
CGGGTTTTAGAGTAGTTATAGCCTTG
381
Exon 17 Reverse
TGGCTGTCTTAAAAGTCAGAAAATC
 
Exon 18 Forward
TTTTGTCTTATCCTCTTAGAAAGGC
259
Exon 18 Reverse
TAGCCAGGGTGGTCTCAATC
 
Exon 19 Forward
TGCTTAATCTGTTAAAATGATGTACTG
383
Exon 19 Reverse
AATTTTAGGTAAACTCCAAAAGTAAGC
 

cDNA amplification

cDNA from a marathon Rapid Amplification of cDNA Ends (RACE)-ready adult human brain library (BD Biosciences, CA) was used as a template to amplify overlapping fragments of the predicted 2 kilobase (kb) transcript. Overlapping primers within each exon were designed using ExonPrimer, and PCR and sequencing were carried out as described above.

Western blotting

Human brain soluble extracts (40 ug per lane) were separated on 4–20% sodium dodecyl sulphate – polyacrylamide gel electrophoresis (SDS-PAGE) gels and blotted using a goat polyclonal antibody to the C-terminus of IFT74 (anti-CMG1, Everest Biotech Ltd, Oxfordshire, UK) at a final antibody concentration of 0.5 ug mL-1. For competition experiments, antibody was pre-incubated with a 10-fold excess (w/w) of immunizing peptide (KTIVDALHSTSGN).

Confocal microscopy

Primary cortical neurons were prepared from E18 rat pups using papain dissociation and were plated on poly-L-lysine coated glass coverslips at 106 cells per dish. After 5 days in vitro, cells were fixed with 4% paraformaldehyde, permeabilized with 0.1% saponin and stained with the goat polyclonal antibody to IFT74 at a concentration of 2.5 mg mL-1. Secondary antibody was donkey anti-goat IgG conjugated to AlexaFluor 488 (1:200, Molecular Probes, Carlsbad, CA) and nuclei were identified with TO-PRO3 (Molecular probes). Coverslips were imaged with a Zeiss LSM510 META confocal microscope using consistent gain and offset settings for samples stained with antibody alone or with antibody plus immunizing peptide. Secondary antibody alone gave no signal.

Results

Previous linkage analysis of F2 using dinucleotide marker data had revealed a single region with a lod score of ~1.5 on chromosome 9p that matched with the published chromosome 9p21.3-p13.3 ALS-FTD locus (figure 2b). Similarly, marker data showed a haplotype across chromosome 9p that segregated with disease status in F476 (figure 2a). Based on these data, F476 and F2 were selected for mutational screening of the 14 candidate genes within the previously defined 2.1 Mb region of the chromosome 9p ALS-FTD locus.
In the course of sequencing the intraflagellar transport gene (IFT74), we identified a C to T sequence variant at nucleotide 1024 in exon 13 in the proband of F476 (III-3, figures 4a and 5). This base pair change predicts a premature stop codon at position 342 of the peptide (Q342X) truncating the last 258 residues. This variant segregated with disease within the family as it was present in the two brothers of the proband diagnosed with ALS-FTD (III-1, III-4). The Q342X sequence variant was not present in four unaffected individuals within the kindred (II-3, III-2, IV-2 & IV-4), in 1,000 chromosomes from North American controls or in 900 chromosomes from the Human Genome Diversity Panel although this C to T base pair change is ostensibly in a library clone derived from human thymus (BX436367, clone CS0CAP001YM04, Life Technologies, Inc). One younger unaffected individual carried the Q342X sequence variant. We did not find IFT74 sequence variants in F2 by sequencing or exonic gene dosage methods (data not shown). Neither F476 or F2 had additional mutations in the other 13 genes within the 9p locus defined by the Dutch, Scandinavian and North American families[1416] or in 47 additional genes in the larger haplotype.
In order to assess the prevalence of IFT74 sequence variants, we sequenced the entire coding region of this gene in a large number of ALS, ALS-FTD and FTD samples (Table 2). The Q342X mutation was not found in any of these patients. However, we identified a G58D (nt173 G to A) sequence variant in a Caucasian woman who developed sporadic semantic dementia without motor involvement at the age of 58 (II-1, figures 4b and 5). This G58D sequence variant was not found in 900 chromosomes from North American controls or in 1,600 chromosomes from the HGDP. We also identified an I55L sequence variant (nt163 A to T) in three additional affected probands; first, the I55L sequence variant was found in the proband of F549 who had been diagnosed with FTD at the age of 62 (figures 4c and 5). His 80-year-old brother (II-7) had been diagnosed with FTD at the age of 75 and carried the I55L sequence variant. A 70-year-old apparently unaffected sister (II-12) also carried the I55L sequence variant; second, the proband of F194, a 59-year-old Caucasian woman diagnosed with ALS-FTD, had the I55L sequence variant. Her sister had died of FTD and her paternal uncle had died of ALS-FTD (DNA samples not available); third, the I55L sequence variant was found in a 67-year-old man with sporadic ALS. He had presented one year before his death with bulbar symptoms including emotional lability, and had become increasingly withdrawn and indifferent to his symptoms during the course of his illness. I55L was not found in 900 chromosomes from North American controls, but it was found in 1 of 1,600 chromosomes from the HGDP in a French sample.
We proceeded to verify that IFT74 is expressed in brain. Refseq (NCBI) provisionally reports the IFT74 gene to contain 14 coding exons based on NM_025103. We sequenced human brain derived cDNA and found a T to A transversion at nt599 of NM_025103 (primers available upon request). This base pair substitution converts a stop codon at position 159 to lysine indicating that IFT74 contains 19 exons encoding a 600 residue protein with a predicted molecular weight of 69.2 kDa. This larger coding region of IFT74 was confirmed by deposited sequences AY040325 and CR617782, which show lysine at codon position 159. Western blotting of human brain lysates with a polyclonal antibody against a peptide from the C-terminus of IFT74 demonstrated two major bands at ~90 kDa and ~70 kDa, of which the lower band is the most prominent (figure 6a). Both of these bands were blocked by pre-absorption of the antibody with the immunizing peptide (data not shown), indicating specificity. These data show that this gene is expressed throughout the adult human brain and also confirmed that IFT74 contains 19 exons. Staining of primary rat cortical neurons with the same antibody demonstrated that IFT74 is localized to vesicles in the cell body and along the neuronal processes (figure 6b).

Discussion

We found sequence variations in the IFT74 gene in patients with ALS-FTD, FTD and sporadic ALS. Five pieces of genetic information suggest that the IFT74 sequence variants are relevant to disease pathogenesis. First, the nonsense sequence variant (Q342X) segregates with disease in a small ALS-FTD kindred. Second, this premature stop codon significantly truncates the IFT74 protein in a manner likely to have a critical effect on the function of this plausible candidate gene. Third, additional sequence variants (G58D and I55L) were found in the IFT74 gene in other disease cases. Fourth, we have sequenced every known gene and predicted transcripts in the candidate region as defined by the minimal interfamily haplotype shared by the Dutch, Scandinavian and North American ALS-FTD families (figure 1) and the gene encoding IFT74 was the only gene that contained variants not identified in the general population and fifth, these mutations are not present in 900 to 1,000 North American control chromosomes.
Against these five pieces of suggestive information are four pieces of evidence against pathogenicity. First, we failed to find a mutation in the second family we used in our screening (F2). Second, the fact that the stop mutation is in the cDNA database in a sample of unknown provenance, third the fact that the I55L mutation is in a sample from France in the CEPH diversity series argues against the pathogenicity of that particular mutation. The genetic linkage reports indicate that mutations at the chromosome 9p locus are incompletely penetrant [14, 15] and this complicates the interpretation of both segregation data within families and of variants in control populations. Fourth: on contacting the senior authors of the original linkage report [14], they were unable to find a point variant in their linked family.

Conclusion

Our data indicate that IFT74 is a 600-residue, 69-kDa coiled-coil containing protein that localizes to the intracellular vesicle compartment. This protein is a component of the intraflagellar transport system responsible for vesicular transport of material synthesized within the cell body into and along the dendritic and axonal processes of human neurons[27]. The importance of vesicle synthesis and axonal transport in motor neuron disease is increasingly recognized. Vesicle associated protein B missense (VAPB) mutations have been identified in familial ALS [5] and the wobbler mouse, an animal model of ALS, is caused by mutations in the vesicular protein sorting factor 54 [28]. Dynactin is the motor protein responsible for retrograde axonal transport and mutations in the p150 subunit of this complex have been described in patients with ALS [29] and ALS-FTD [30]. Furthermore, a mutation in the antegrade axonal transport kinesin gene, KIF1B, has been described in a single family with Charcot-Marie-Tooth disease-2A1, a hereditary motor and sensory axonal neuropathy (OMIM 118210). Given its role in vesicle transport, IFT74 is a plausible biological candidate to explain the neurodegeneration characteristic of both ALS and FTD phenotypes in a subset of patients. However, as the Q342X mutation was found in a cDNA library and in an (as yet) unaffected family member, there is currently no clear evidence that this mutation is of causal significance and IFT74 may just be a risk factor for ALS-FTD. Clearly, more work will be needed to determine its role, if any.

Accession numbers

Intraflagellar transport 74 homolog (IFT74, also known as capillary morphogenesis protein 1 (CMG1); coiled-coil domain containing 2 (CCDC2); FLJ22621): GeneID 80173; UniGene Hs.145402; mRNA: AY040325 (gi:15418996); protein: AAK77221 (GI:15418997); SOD1 (NM_000454); MAPT (NM_016835); GRN (NM_002087).

Online Mendelian inheritance in man [31]

Amyotrophic lateral sclerosis [ALS, OMIM 105400]; Fronto-temporal dementia [FTD, OMIM 600274]; Fronto-temporal dementia/amyotrophic lateral sclerosis [ALS/FTD, OMIM 105550], Intraflagellar transport protein 74 (IFT74), previously CCDC2, CMG1 [OMIM 608040]

Acknowledgements

We gratefully acknowledge the assistance of the New York Brain Bank – The Taub Institute, Columbia University (Federal grant number P50 AG08702) and the University of Miami/National Parkinson Foundation Brain Endowment Bank (funded by the National Parkinson Foundation, Inc., Miami, FL and other private donations). North American control samples for this study were obtained from the NINDS Neurogenetics repository at the Coriell Institute for Medical Research, Camden, NJ. This work was supported by NIH grant # P50 AG05681 (NJC). This research was supported (in part) by the Intramural Program of the NIA, NIMH and NINDS.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The author(s) declare that they have no competing interests.

Authors' contributions

PM, JS and SJ contributed equally to this work. PM, JS, SJ and SB carried out the molecular genetic studies, participated in the sequence alignment and drafted the manuscript. AS, JH and BJT conceived of the study, participated in its design and coordination, performed data analysis and drafted the manuscript. MRC and EG carried out the immunoassays and drafted the manuscript. NJC and DMH performed the autopsy, provided the photomicrographs and participated in writing the manuscript. MJG, SP, AC, HCF, EH, EW, JA, MLH, ER, PS, JDR, OH and JG were involved in ascertaining patients, providing phenotype data, obtained DNA samples and participated in editing the manuscript. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Rowland LP, Shneider NA: Amyotrophic lateral sclerosis. N Engl J Med. 2001, 344: 1688-1700. 10.1056/NEJM200105313442207.CrossRefPubMed Rowland LP, Shneider NA: Amyotrophic lateral sclerosis. N Engl J Med. 2001, 344: 1688-1700. 10.1056/NEJM200105313442207.CrossRefPubMed
2.
Zurück zum Zitat Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, et al: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993, 362: 59-62. 10.1038/362059a0.CrossRefPubMed Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, Donaldson D, Goto J, O'Regan JP, Deng HX, et al: Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature. 1993, 362: 59-62. 10.1038/362059a0.CrossRefPubMed
3.
Zurück zum Zitat Yang Y, Hentati A, Deng HX, Dabbagh O, Sasaki T, Hirano M, Hung WY, Ouahchi K, Yan J, Azim AC, Cole N, Gascon G, Yagmour A, Ben Hamida M, Pericak-Vance M, Hentati F, Siddique T: The gene encoding alsin, a protein with three guanine-nucleotide exchange factor domains, is mutated in a form of recessive amyotrophic lateral sclerosis. Nat Genet. 2001, 29: 160-165. 10.1038/ng1001-160.CrossRefPubMed Yang Y, Hentati A, Deng HX, Dabbagh O, Sasaki T, Hirano M, Hung WY, Ouahchi K, Yan J, Azim AC, Cole N, Gascon G, Yagmour A, Ben Hamida M, Pericak-Vance M, Hentati F, Siddique T: The gene encoding alsin, a protein with three guanine-nucleotide exchange factor domains, is mutated in a form of recessive amyotrophic lateral sclerosis. Nat Genet. 2001, 29: 160-165. 10.1038/ng1001-160.CrossRefPubMed
4.
Zurück zum Zitat Chen YZ, Bennett CL, Huynh HM, Blair IP, Puls I, Irobi J, Dierick I, Abel A, Kennerson ML, Rabin BA, Nicholson GA, Auer-Grumbach M, Wagner K, De Jonghe P, Griffin JW, Fischbeck KH, Timmerman V, Cornblath DR, Chance PF: DNA/RNA helicase gene mutations in a form of juvenile amyotrophic lateral sclerosis (ALS4). Am J Hum Genet. 2004, 74: 1128-1135. 10.1086/421054.CrossRefPubMedPubMedCentral Chen YZ, Bennett CL, Huynh HM, Blair IP, Puls I, Irobi J, Dierick I, Abel A, Kennerson ML, Rabin BA, Nicholson GA, Auer-Grumbach M, Wagner K, De Jonghe P, Griffin JW, Fischbeck KH, Timmerman V, Cornblath DR, Chance PF: DNA/RNA helicase gene mutations in a form of juvenile amyotrophic lateral sclerosis (ALS4). Am J Hum Genet. 2004, 74: 1128-1135. 10.1086/421054.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Nishimura AL, Mitne-Neto M, Silva HC, Richieri-Costa A, Middleton S, Cascio D, Kok F, Oliveira JR, Gillingwater T, Webb J, Skehel P, Zatz M: A mutation in the vesicle-trafficking protein VAPB causes late-onset spinal muscular atrophy and amyotrophic lateral sclerosis. Am J Hum Genet. 2004, 75: 822-831. 10.1086/425287.CrossRefPubMedPubMedCentral Nishimura AL, Mitne-Neto M, Silva HC, Richieri-Costa A, Middleton S, Cascio D, Kok F, Oliveira JR, Gillingwater T, Webb J, Skehel P, Zatz M: A mutation in the vesicle-trafficking protein VAPB causes late-onset spinal muscular atrophy and amyotrophic lateral sclerosis. Am J Hum Genet. 2004, 75: 822-831. 10.1086/425287.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Chow TW, Miller BL, Hayashi VN, Geschwind DH: Inheritance of frontotemporal dementia. Arch Neurol. 1999, 56: 817-822. 10.1001/archneur.56.7.817.CrossRefPubMed Chow TW, Miller BL, Hayashi VN, Geschwind DH: Inheritance of frontotemporal dementia. Arch Neurol. 1999, 56: 817-822. 10.1001/archneur.56.7.817.CrossRefPubMed
7.
Zurück zum Zitat Snowden JS, Neary D, Mann DM: Frontotemporal dementia. Br J Psychiatry. 2002, 180: 140-143. 10.1192/bjp.180.2.140.CrossRefPubMed Snowden JS, Neary D, Mann DM: Frontotemporal dementia. Br J Psychiatry. 2002, 180: 140-143. 10.1192/bjp.180.2.140.CrossRefPubMed
8.
Zurück zum Zitat Rosso SM, Donker KL, Baks T, Joosse M, de K, Pijnenburg Y, de Jong D, Dooijes D, Kamphorst W, Ravid R, Niermeijer MF, Verheij F, Kremer HP, Scheltens P, van Duijn CM, Heutink P, van Swieten JC: Frontotemporal dementia in The Netherlands: patient characteristics and prevalence estimates from a population-based study. Brain. 2003, 126: 2016-2022. 10.1093/brain/awg204.CrossRefPubMed Rosso SM, Donker KL, Baks T, Joosse M, de K, Pijnenburg Y, de Jong D, Dooijes D, Kamphorst W, Ravid R, Niermeijer MF, Verheij F, Kremer HP, Scheltens P, van Duijn CM, Heutink P, van Swieten JC: Frontotemporal dementia in The Netherlands: patient characteristics and prevalence estimates from a population-based study. Brain. 2003, 126: 2016-2022. 10.1093/brain/awg204.CrossRefPubMed
9.
Zurück zum Zitat Ince PG, Lowe J, Shaw PJ: Amyotrophic lateral sclerosis: current issues in classification, pathogenesis and molecular pathology. Neuropathol Appl Neurobiol. 1998, 24: 104-117. 10.1046/j.1365-2990.1998.00108.x.CrossRefPubMed Ince PG, Lowe J, Shaw PJ: Amyotrophic lateral sclerosis: current issues in classification, pathogenesis and molecular pathology. Neuropathol Appl Neurobiol. 1998, 24: 104-117. 10.1046/j.1365-2990.1998.00108.x.CrossRefPubMed
10.
Zurück zum Zitat Hudson AJ: Amyotrophic lateral sclerosis and its association with dementia, parkinsonism and other neurological disorders: a review. Brain. 1981, 104: 217-247.CrossRefPubMed Hudson AJ: Amyotrophic lateral sclerosis and its association with dementia, parkinsonism and other neurological disorders: a review. Brain. 1981, 104: 217-247.CrossRefPubMed
11.
Zurück zum Zitat Lomen-Hoerth C, Murphy J, Langmore S, Kramer JH, Olney RK, Miller B: Are amyotrophic lateral sclerosis patients cognitively normal?. Neurology. 2003, 60: 1094-1097.CrossRefPubMed Lomen-Hoerth C, Murphy J, Langmore S, Kramer JH, Olney RK, Miller B: Are amyotrophic lateral sclerosis patients cognitively normal?. Neurology. 2003, 60: 1094-1097.CrossRefPubMed
12.
Zurück zum Zitat Lomen-Hoerth C, Anderson T, Miller B: The overlap of amyotrophic lateral sclerosis and frontotemporal dementia. Neurology. 2002, 59: 1077-1079.CrossRefPubMed Lomen-Hoerth C, Anderson T, Miller B: The overlap of amyotrophic lateral sclerosis and frontotemporal dementia. Neurology. 2002, 59: 1077-1079.CrossRefPubMed
13.
Zurück zum Zitat Wilson CM, Grace GM, Munoz DG, He BP, Strong MJ: Cognitive impairment in sporadic ALS: a pathologic continuum underlying a multisystem disorder. Neurology. 2001, 57: 651-657.CrossRefPubMed Wilson CM, Grace GM, Munoz DG, He BP, Strong MJ: Cognitive impairment in sporadic ALS: a pathologic continuum underlying a multisystem disorder. Neurology. 2001, 57: 651-657.CrossRefPubMed
14.
Zurück zum Zitat Vance C, Al Chalabi A, Ruddy D, Smith BN, Hu X, Sreedharan J, Siddique T, Schelhaas HJ, Kusters B, Troost D, Baas F, de J, Shaw CE: Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3. Brain. 2006, 129: 868-876. 10.1093/brain/awl030.CrossRefPubMed Vance C, Al Chalabi A, Ruddy D, Smith BN, Hu X, Sreedharan J, Siddique T, Schelhaas HJ, Kusters B, Troost D, Baas F, de J, Shaw CE: Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3. Brain. 2006, 129: 868-876. 10.1093/brain/awl030.CrossRefPubMed
15.
Zurück zum Zitat Morita M, Al Chalabi A, Andersen PM, Hosler B, Sapp P, Englund E, Mitchell JE, Habgood JJ, de Belleroche J, Xi J, Jongjaroenprasert W, Horvitz HR, Gunnarsson LG, Brown RH: A locus on chromosome 9p confers susceptibility to ALS and frontotemporal dementia. Neurology. 2006, 66: 839-844. 10.1212/01.wnl.0000200048.53766.b4.CrossRefPubMed Morita M, Al Chalabi A, Andersen PM, Hosler B, Sapp P, Englund E, Mitchell JE, Habgood JJ, de Belleroche J, Xi J, Jongjaroenprasert W, Horvitz HR, Gunnarsson LG, Brown RH: A locus on chromosome 9p confers susceptibility to ALS and frontotemporal dementia. Neurology. 2006, 66: 839-844. 10.1212/01.wnl.0000200048.53766.b4.CrossRefPubMed
16.
Zurück zum Zitat Yan J, Siddique T: A Major Novel Locus for ALS/FTD on Chromosome 9p21 and its Pathological Correlates. American Academy of Neurology, 58th Annual Meeting, April 2006. 2006 Yan J, Siddique T: A Major Novel Locus for ALS/FTD on Chromosome 9p21 and its Pathological Correlates. American Academy of Neurology, 58th Annual Meeting, April 2006. 2006
17.
Zurück zum Zitat El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. 2006 El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis. 2006
18.
Zurück zum Zitat NCBI build 36, http://www.ncbi.nlm.nih.gov/mapview/. 2006 NCBI build 36, http://​www.​ncbi.​nlm.​nih.​gov/​mapview/​.​ 2006
19.
Zurück zum Zitat http://www.ensembl.org/index.html. 2006 http://www.ensembl.org/index.html. 2006
20.
Zurück zum Zitat http://ihg.gsf.de/ihg/ExonPrimer.html. 2006 http://ihg.gsf.de/ihg/ExonPrimer.html. 2006
21.
Zurück zum Zitat Mase G, Ros S, Gemma A, Bonfigli L, Carraro N, Cazzato G, Rolfo M, Zanconati F, Sepcic J, Jurjevic A, Pirulli D, Boniotto M, Zezlina S, Crovella S, Amoroso A: ALS with variable phenotypes in a six-generation family caused by leu144phe mutation in the SOD1 gene. J Neurol Sci. 2001, 191: 11-18. 10.1016/S0022-510X(01)00625-6.CrossRefPubMed Mase G, Ros S, Gemma A, Bonfigli L, Carraro N, Cazzato G, Rolfo M, Zanconati F, Sepcic J, Jurjevic A, Pirulli D, Boniotto M, Zezlina S, Crovella S, Amoroso A: ALS with variable phenotypes in a six-generation family caused by leu144phe mutation in the SOD1 gene. J Neurol Sci. 2001, 191: 11-18. 10.1016/S0022-510X(01)00625-6.CrossRefPubMed
22.
Zurück zum Zitat Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering-Brown S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, Dickson D, Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Baren J, Hillebrand M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, Morris JC, Reed LA, Trojanowski J, Basun H, Lannfelt L, Neystat M, Fahn S, Dark F, Tannenberg T, Dodd PR, Hayward N, Kwok JB, Schofield PR, Andreadis A, Snowden J, Craufurd D, Neary D, Owen F, Oostra BA, Hardy J, Goate A, van Swieten J, Mann D, Lynch T, Heutink P: Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature. 1998, 393: 702-705. 10.1038/31508.CrossRefPubMed Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering-Brown S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, Dickson D, Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Baren J, Hillebrand M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, Morris JC, Reed LA, Trojanowski J, Basun H, Lannfelt L, Neystat M, Fahn S, Dark F, Tannenberg T, Dodd PR, Hayward N, Kwok JB, Schofield PR, Andreadis A, Snowden J, Craufurd D, Neary D, Owen F, Oostra BA, Hardy J, Goate A, van Swieten J, Mann D, Lynch T, Heutink P: Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature. 1998, 393: 702-705. 10.1038/31508.CrossRefPubMed
23.
Zurück zum Zitat Cruts M, Gijselinck I, van der ZJ, Engelborghs S, Wils H, Pirici D, Rademakers R, Vandenberghe R, Dermaut B, Martin JJ, van Duijn C, Peeters K, Sciot R, Santens P, De Pooter T, Mattheijssens M, Van den BM, Cuijt I, Vennekens K, De Deyn PP, Kumar-Singh S, Van Broeckhoven C: Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature. 2006 Cruts M, Gijselinck I, van der ZJ, Engelborghs S, Wils H, Pirici D, Rademakers R, Vandenberghe R, Dermaut B, Martin JJ, van Duijn C, Peeters K, Sciot R, Santens P, De Pooter T, Mattheijssens M, Van den BM, Cuijt I, Vennekens K, De Deyn PP, Kumar-Singh S, Van Broeckhoven C: Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature. 2006
24.
Zurück zum Zitat Baker M, Mackenzie IR, Pickering-Brown SM, Gass J, Rademakers R, Lindholm C, Snowden J, Adamson J, Sadovnick AD, Rollinson S, Cannon A, Dwosh E, Neary D, Melquist S, Richardson A, Dickson D, Berger Z, Eriksen J, Robinson T, Zehr C, Dickey CA, Crook R, McGowan E, Mann D, Boeve B, Feldman H, Hutton M: Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature. 2006 Baker M, Mackenzie IR, Pickering-Brown SM, Gass J, Rademakers R, Lindholm C, Snowden J, Adamson J, Sadovnick AD, Rollinson S, Cannon A, Dwosh E, Neary D, Melquist S, Richardson A, Dickson D, Berger Z, Eriksen J, Robinson T, Zehr C, Dickey CA, Crook R, McGowan E, Mann D, Boeve B, Feldman H, Hutton M: Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature. 2006
25.
Zurück zum Zitat Momeni P, Cairns NJ, Perry RH, Bigio EH, Gearing M, Singleton AB, Hardy J: Mutation analysis of patients with neuronal intermediate filament inclusion disease (NIFID). Neurobiol Aging. 2006, 27: 778-779. 10.1016/j.neurobiolaging.2005.03.030.CrossRefPubMed Momeni P, Cairns NJ, Perry RH, Bigio EH, Gearing M, Singleton AB, Hardy J: Mutation analysis of patients with neuronal intermediate filament inclusion disease (NIFID). Neurobiol Aging. 2006, 27: 778-779. 10.1016/j.neurobiolaging.2005.03.030.CrossRefPubMed
26.
Zurück zum Zitat Cann HM, de Toma C, Cazes L, Legrand MF, Morel V, Piouffre L, Bodmer J, Bodmer WF, Bonne-Tamir B, Cambon-Thomsen A, Chen Z, Chu J, Carcassi C, Contu L, Du R, Excoffier L, Ferrara GB, Friedlaender JS, Groot H, Gurwitz D, Jenkins T, Herrera RJ, Huang X, Kidd J, Kidd KK, Langaney A, Lin AA, Mehdi SQ, Parham P, Piazza A, Pistillo MP, Qian Y, Shu Q, Xu J, Zhu S, Weber JL, Greely HT, Feldman MW, Thomas G, Dausset J, Cavalli-Sforza LL: A human genome diversity cell line panel. Science. 2002, 296: 261-262. 10.1126/science.296.5566.261b.CrossRefPubMed Cann HM, de Toma C, Cazes L, Legrand MF, Morel V, Piouffre L, Bodmer J, Bodmer WF, Bonne-Tamir B, Cambon-Thomsen A, Chen Z, Chu J, Carcassi C, Contu L, Du R, Excoffier L, Ferrara GB, Friedlaender JS, Groot H, Gurwitz D, Jenkins T, Herrera RJ, Huang X, Kidd J, Kidd KK, Langaney A, Lin AA, Mehdi SQ, Parham P, Piazza A, Pistillo MP, Qian Y, Shu Q, Xu J, Zhu S, Weber JL, Greely HT, Feldman MW, Thomas G, Dausset J, Cavalli-Sforza LL: A human genome diversity cell line panel. Science. 2002, 296: 261-262. 10.1126/science.296.5566.261b.CrossRefPubMed
27.
Zurück zum Zitat Goldstein LS, Philp AV: The road less traveled: emerging principles of kinesin motor utilization. Annu Rev Cell Dev Biol. 1999, 15: 141-183. 10.1146/annurev.cellbio.15.1.141.CrossRefPubMed Goldstein LS, Philp AV: The road less traveled: emerging principles of kinesin motor utilization. Annu Rev Cell Dev Biol. 1999, 15: 141-183. 10.1146/annurev.cellbio.15.1.141.CrossRefPubMed
28.
Zurück zum Zitat Schmitt-John T, Drepper C, Mussmann A, Hahn P, Kuhlmann M, Thiel C, Hafner M, Lengeling A, Heimann P, Jones JM, Meisler MH, Jockusch H: Mutation of Vps54 causes motor neuron disease and defective spermiogenesis in the wobbler mouse. Nat Genet. 2005, 37: 1213-1215. 10.1038/ng1661.CrossRefPubMed Schmitt-John T, Drepper C, Mussmann A, Hahn P, Kuhlmann M, Thiel C, Hafner M, Lengeling A, Heimann P, Jones JM, Meisler MH, Jockusch H: Mutation of Vps54 causes motor neuron disease and defective spermiogenesis in the wobbler mouse. Nat Genet. 2005, 37: 1213-1215. 10.1038/ng1661.CrossRefPubMed
29.
Zurück zum Zitat Munch C, Sedlmeier R, Meyer T, Homberg V, Sperfeld AD, Kurt A, Prudlo J, Peraus G, Hanemann CO, Stumm G, Ludolph AC: Point mutations of the p150 subunit of dynactin (DCTN1) gene in ALS. Neurology. 2004, 63: 724-726.CrossRefPubMed Munch C, Sedlmeier R, Meyer T, Homberg V, Sperfeld AD, Kurt A, Prudlo J, Peraus G, Hanemann CO, Stumm G, Ludolph AC: Point mutations of the p150 subunit of dynactin (DCTN1) gene in ALS. Neurology. 2004, 63: 724-726.CrossRefPubMed
30.
Zurück zum Zitat Munch C, Rosenbohm A, Sperfeld AD, Uttner I, Reske S, Krause BJ, Sedlmeier R, Meyer T, Hanemann CO, Stumm G, Ludolph AC: Heterozygous R1101K mutation of the DCTN1 gene in a family with ALS and FTD. Ann Neurol. 2005, 58: 777-780. 10.1002/ana.20631.CrossRefPubMed Munch C, Rosenbohm A, Sperfeld AD, Uttner I, Reske S, Krause BJ, Sedlmeier R, Meyer T, Hanemann CO, Stumm G, Ludolph AC: Heterozygous R1101K mutation of the DCTN1 gene in a family with ALS and FTD. Ann Neurol. 2005, 58: 777-780. 10.1002/ana.20631.CrossRefPubMed
31.
Zurück zum Zitat http://www.ncbi.nlm.nih.gov/Omim. 2006 http://www.ncbi.nlm.nih.gov/Omim. 2006
32.
Zurück zum Zitat Momeni P, Rogaeva E, Van Deerlin V, Grafman J, Tierney M, Huey E, Bell J, Morris CM, Kalaria RN, van Rensburg SJ, Niehaus D, Potocnik F, Kawarai T, Salehi-Rad S, Sato C, St George-Hyslop P, Hardy J: Genetic Variability in CHMP2b and Frontotemporal Dementia. Neurodegenerative Disease. 2006 Momeni P, Rogaeva E, Van Deerlin V, Grafman J, Tierney M, Huey E, Bell J, Morris CM, Kalaria RN, van Rensburg SJ, Niehaus D, Potocnik F, Kawarai T, Salehi-Rad S, Sato C, St George-Hyslop P, Hardy J: Genetic Variability in CHMP2b and Frontotemporal Dementia. Neurodegenerative Disease. 2006
33.
Zurück zum Zitat Johnson J, Ostojic J, Lannfelt L, Glaser A, Basun H, Rogaeva E, Kawarai T, Bruni A, George Hyslop PH, Goate A, Pastor P, Chakraverty S, Norton J, Morris JC, Hardy J, Singleton A: No evidence for tau duplications in frontal temporal dementia families showing genetic linkage to the tau locus in which tau mutations have not been found. Neurosci Lett. 2004, 363: 99-101. 10.1016/j.neulet.2004.03.070.CrossRefPubMed Johnson J, Ostojic J, Lannfelt L, Glaser A, Basun H, Rogaeva E, Kawarai T, Bruni A, George Hyslop PH, Goate A, Pastor P, Chakraverty S, Norton J, Morris JC, Hardy J, Singleton A: No evidence for tau duplications in frontal temporal dementia families showing genetic linkage to the tau locus in which tau mutations have not been found. Neurosci Lett. 2004, 363: 99-101. 10.1016/j.neulet.2004.03.070.CrossRefPubMed
34.
Zurück zum Zitat Greenway MJ, Andersen PM, Russ C, Ennis S, Cashman S, Donaghy C, Patterson V, Swingler R, Kieran D, Prehn J, Morrison KE, Green A, Acharya KR, Brown RH, Hardiman O: ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis. Nat Genet. 2006, 38: 411-413. 10.1038/ng1742.CrossRefPubMed Greenway MJ, Andersen PM, Russ C, Ennis S, Cashman S, Donaghy C, Patterson V, Swingler R, Kieran D, Prehn J, Morrison KE, Green A, Acharya KR, Brown RH, Hardiman O: ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis. Nat Genet. 2006, 38: 411-413. 10.1038/ng1742.CrossRefPubMed
Metadaten
Titel
Analysis of IFT74as a candidate gene for chromosome 9p-linked ALS-FTD
verfasst von
Parastoo Momeni
Jennifer Schymick
Shushant Jain
Mark R Cookson
Nigel J Cairns
Elisa Greggio
Matthew J Greenway
Stephen Berger
Stuart Pickering-Brown
Adriano Chiò
Hon Chung Fung
David M Holtzman
Edward D Huey
Eric M Wassermann
Jennifer Adamson
Michael L Hutton
Ekaterina Rogaeva
Peter St George-Hyslop
Jeffrey D Rothstein
Orla Hardiman
Jordan Grafman
Andrew Singleton
John Hardy
Bryan J Traynor
Publikationsdatum
01.12.2006
Verlag
BioMed Central
Erschienen in
BMC Neurology / Ausgabe 1/2006
Elektronische ISSN: 1471-2377
DOI
https://doi.org/10.1186/1471-2377-6-44

Weitere Artikel der Ausgabe 1/2006

BMC Neurology 1/2006 Zur Ausgabe

Neu in den Fachgebieten Neurologie und Psychiatrie

Blutdrucksenkung schon im Rettungswagen bei akutem Schlaganfall?

31.05.2024 Apoplex Nachrichten

Der optimale Ansatz für die Blutdruckkontrolle bei Patientinnen und Patienten mit akutem Schlaganfall ist noch nicht gefunden. Ob sich eine frühzeitige Therapie der Hypertonie noch während des Transports in die Klinik lohnt, hat jetzt eine Studie aus China untersucht.

Nicht Creutzfeldt Jakob, sondern Abführtee-Vergiftung

29.05.2024 Hyponatriämie Nachrichten

Eine ältere Frau trinkt regelmäßig Sennesblättertee gegen ihre Verstopfung. Der scheint plötzlich gut zu wirken. Auf Durchfall und Erbrechen folgt allerdings eine Hyponatriämie. Nach deren Korrektur kommt es plötzlich zu progredienten Kognitions- und Verhaltensstörungen.

Schutz der Synapsen bei Alzheimer

29.05.2024 Morbus Alzheimer Nachrichten

Mit einem Neurotrophin-Rezeptor-Modulator lässt sich möglicherweise eine bestehende Alzheimerdemenz etwas abschwächen: Erste Phase-2-Daten deuten auf einen verbesserten Synapsenschutz.

Hörschwäche erhöht Demenzrisiko unabhängig von Beta-Amyloid

29.05.2024 Hörstörungen Nachrichten

Hört jemand im Alter schlecht, nimmt das Hirn- und Hippocampusvolumen besonders schnell ab, was auch mit einem beschleunigten kognitiven Abbau einhergeht. Und diese Prozesse scheinen sich unabhängig von der Amyloidablagerung zu ereignen.