Background
Alzheimer's disease (AD) is the major cause of dementia. The cognitive impairment is associated with the degeneration of particular subsets of neurons in regions involved in learning and memory processes. In addition another invariant feature of AD is neuroinflammation, considered a consequence of glial activation and reflected as astrogliosis and microglial activation, in particular around senile plaques, one of the pathological hallmarks of the disease, along neurofibrillary tangles. Indeed, lots of inflammatory parameters are found in AD brains [
1,
2]. Once initiated the inflammatory process it may contribute independently to neural dysfunction and cell death, establishing a self-perpetuating vicious cycle by which inflammation induces further neurodegeneration. The recognition of inflammation as an important component in the disease led to the discovery that prolonged treatment with non-steroidal anti-inflammatories (NSAIDS) had beneficial effects for AD. Indeed, several prospective works have shown that this kind of treatment markedly reduced the risk of suffering the neurologic condition, delayed its onset, ameliorated the symptomatic severity and slowed cognitive decline [
3‐
5]. However their administration to already demented patients may be ineffective, suggesting the importance of early administration or, alternatively, the existence of additional targets of NSAIDs, besides cycloxygenase inhibition. Nevertheless, other compounds with anti-inflammatory activity may be disease modifying drugs, which may delay onset or slow its progression, in contrast with the present AD palliative treatment.
Cannabinoids, whether plant derived, synthetic or endocannabinoids, interact with two well characterized cannabinoid receptors, CB
1 and CB
2 [
6,
7]. In addition, some cannabinoids may interact with other receptors, such as the TRPV
1 receptor or the orphan receptor GPR55 [
8,
9]. The CB
1 receptor is widely distributed, with a particularly high expression in brain, which contrasts with the limited expression of the CB
2 receptor, which is characteristic of immune organs and cells [
10]. In fact, while CB
1 receptors are expressed by all types of cells in the brain (neurons and glial cells), CB
2 are mainly localized in microglial cells [
6,
9‐
11], the resident immune cell of the brain.
We and others have proposed cannabinoids as preventive treatment for AD [
12‐
14], based on their neuroprotective [
15,
16] and anti-inflammatory effects [
11,
17,
18]. Indeed, cannabinoids are able to decrease the release of cytokines and nitric oxide in cultured microglial cells induced by lipopolysacharide [
19,
20] and Aβ addition [
12,
21]. In several
in vitro studies cannabidiol (CBD), the major non-psychotropic constituent of cannabis, has shown to be neuroprotective against β-amyloid (Aβ) addition to cultured cells. This action was a consequence of reduction of oxidative stress and blockade of apoptosis [
22], tau-phosphorylation inhibition through the Wnt/β-catenin pathway [
23] and decreased iNOS expression and nitrite generation [
24].
In vivo experiments have shown that several cannabinoids were effective at preventing Alzheimer's disease related changes. In a previous work we have reported that synthetic cannabinoids, such as WIN55,212-2 and JWH-133, prevented the cognitive impairment, glial activation and neuronal marker loss in β-amyloid injected rats [
12]. Enhancement of endocannabinoid levels by subchronic uptake inhibition reversed the increase in inflammatory parameters, such as COX-2, TNF-α and IL-1, in Aβ-injected mice, although cognitive impairment was only prevented in early treated mice [
25]. Further, we have recently reported that CBD and WIN55,212-2 (WIN) inhibited both glial activation and cognitive deficits, as judged in the water maze test, and by a mechanism involving decreasing microglial activation, as shown in cultured microglial cells [
20].
So far the possible effects of cannabinoids have not been studied in a genetic AD model, which mimics the amyloidosis and neuroinflammation [
26,
27] that occurs in the neurologic condition, in the absence of overt neurodegeneration [
28]. Therefore in this work we have addressed the question whether cannabinoid agonists would ameliorate the cognitive deficits, neuroinflammation and altered Aβ levels in this AD model. To that end we have used WIN 55,212-2 (WIN), a mixed CB
1/CB
2 agonist [
6] and JWH-133 (JWH) as selective CB
2 agonist [
29]. The CB
2 selective agonist is devoid of psychoactivity, an advantage for its clinical endorsement, however we reasoned that a low dose of WIN may be free of psychoactive effects as well. The drugs were administered in drinking water [
30] for a prolonged period, 4 months, to mimic a possible clinical setting. Given that cannabinoid treatment may be preventive, but not curative, administration of drugs was started at 7 months of age, when no cognitive dysfunction or plaque deposition exists, and it was prolonged for 4 months (eg until 11 months of age). We report here that such a treatment ameliorates cognitive performance, decreases neuroinflammation and Aβ levels, likely by increasing its transport to the periphery.
Discussion
In this work we describe several beneficial effects of the prolonged oral treatment with two cannabinoid agonists with different pharmacological profiles. Both cannabinoids were effective at decreasing the inflammatory parameters and Aβ levels. However, it was the CB2 selective agonist JWH that was able to prevent cognitive deficits and glucose metabolism reduction.
Our results differ from a recent work [
36] reporting variable effects on water maze performance and fear conditioning, no changes in Aβ levels or plaque burden following subchronic treatment with the CB
1/CB
2 mixed agonist HU-210. Methodological differences may account for the results, since they used male and female double APP23/PS1 transgenic mice, at 4 (young) or 6-9 weeks of age, and a very low dose of the cannabinoid agonist (10 or 50 μg/kg) injected twice daily [
14].
CB
1 activation induces psychoactive effects. In fact mixed CB
1/CB
2 and CB
1 selective agonists after acute administration decrease motor activity and impair learning and memory [
37‐
39], although at higher doses than the one we used in this study (0.2 mg/kg/day). However, chronic administration of those drugs induces tolerance to their acute effects in different behavioural tests [
40,
41]. Therefore, the fact that WIN did not affect learning in the novel object recognition test in wild type mice might suggest tolerance after prolonged administration. Similarly WIN was without effect on recognition memory of Tg APP mice. In contrast, CB
2 selective agonists, such as JWH, are devoid of psychoactivity after acute administration and does not alter motor activity [[
42], Martín-Moreno et al., in preparation] after systemic administration or object recognition memory following its intrahippocampal injection [
43]. After prolonged administration to wild type mice JWH neither altered learning nor memory in the present work. Interestingly this compound effectively counteracted the cognitive impairment of Tg APP mice.
The brain is the organ with the highest glucose consumption, which is believed to be coupled to neural activity. The reduction in brain glucose uptake has been repeatedly demonstrated in AD patients [
31,
44], in particular in regions involved in memory, and it is highly correlated with cognitive deficits. Prolonged oral WIN administration reduced glucose uptake, as measured by PET
18F-DG, in wild type mice in cortical regions and hippocampus. This result may be deleterious, in spite of the observation of no memory impairment in the cognitive test selected. In fact, previous autoradiographic work has reported either normal
3H-DG uptake in hippocampus or a decrease, depending on the dose of WIN [
45] acutely administered. Decreased
18F-DG uptake in Tg APP in the present work is in essential agreement with previous reports, either by autoradiographic techniques [
46] or PET [
47]. Notably JWH administration for 4 months did not alter glucose uptake in wild type mice, while it completely abrogated the reduction observed in Tg APP. Brain activity in general, and cognition in particular rely on glucose metabolism [
47], therefore the effects of the CB
2 agonist on both glucose utilization and recognition memory are of therapeutic interest.
Inflammation has several drawbacks including learning and memory impairment [
48], in particular during ageing [
49,
50]. The compounds under study behaved as anti-inflammatory agents, in agreement with previous reports [
11,
12,
20,
25,
49‐
51]. Microglial activation, but not astrogliosis, was observed in 11 month old Tg APP mice. Previous works have shown prominent reactive astrogliosis and increased GFAP expression in transgenic mice, that appears to be age-dependent and related with disease progression [
26,
28,
52], albeit being restricted to plaques. The lack of astrogliosis and changes in GFAP expression may be explained by the absence of plaques in the mice model at this age. This result is in agreement with the detection of GFAP mRNA, as assessed by non-radioactive
in situ hybridization, in reactive astrocytes in close proximity with Aβ plaques at 14 months of age, but not before, when plaques were absent [
53]. Indeed we found no plaques with glial associated cells, although there was a significant enhancement in microglial cell density in Tg APP mice. Continuous JWH treatment for 4 months normalized this parameter, but WIN was ineffective. In different contexts (eg lesions) both astrocytes and microglia could be engaged in inflammation. However in light of those results we can ascribe the increase in inflammatory mediators to microglial activation, given that there was no overt astrogliosis. COX-2 protein levels and TNF-α mRNA expression is increased in AD and its transgenic model [
54,
55]. Both cannabinoids significantly decreased COX-2 and TNF-α, as expected, since both compounds share CB
2 receptor activation, as shown by the down-regulation of its expression in Tg APP mice. It should be noted that although CB
2 receptors could be expressed by some neurons [
56] they are mainly expressed by microglial cells [
6,
9‐
11], and are involved in the modulation of several inflammatory mediators [
12,
19‐
21,
25]. We did expect an increase in CB
2 receptor expression in the transgenic model given that Aβ addition to microglial cultures enhance it [
21]. However, in Tg APP mice we did not observe CB
2 co-localization with Iba-1, which contrasts with the microglial co-expression in AD brain [
13,
33]. We neither found an increase by Western blotting, in agreement with our previous results in AD patients or Aβ-injected rats [
12]. This supports the notion that at this age there is an ongoing glial activation of low magnitude in Tg APP and that cannabinoids down-modulate this response.
Aβ removal is considered a therapeutic strategy in AD, promoted either by vaccination [
57,
58] or by enhancing its clearance towards the periphery [
59,
60]. One of the most interesting findings of the present work is the Aβ lowering ability of both cannabinoids, which we report for the first time. Prolonged oral JWH treatment decreased Aβ
1-40 levels in brain and both cannabinoids decreased the more amyloidogenic fragment, Aβ
1-42. Given that the drugs did not alter Aβ release we speculated that APP cleavage was not altered, and therefore studied whether cannabinoids changed the peptide transport
in vitro. Rat choroid plexus expressed CB
1, in agreement with [
34], and also CB
2 receptor protein, making feasible their activation by the drugs under study. Cannabinoids favored Aβ transport, that was mainly observed at shorter times (1-3 h) compared to control experiments. This interesting effect merits further study.
At variance with those effects oral treatment with WIN, but not JWH, normalized the levels of GSK3-β in Tg APP mice. Neurofibrillary tangles (NFTs), resulting from an abnormal phosphorylation of microtubule-associated tau proteins, represent a key pathological hallmark of Alzheimer's brain. GSK3-β is the kinase mainly responsible for tau hyperphosphorylation, therefore inhibiting its activity is considered of therapeutic interest. The effect of WIN after prolonged oral administration is in accordance with reports showing a CB
1 dependent increase in GSK3-β phosphorylation in cultured cells [
61], in brain after acute cannabinoid agonist administration [
62], and with a reduction in tau phosphorylation [
23]. Neurofibrillary tangles are intraneuronal elements and neurons are in general devoid of CB
2 receptors. Therefore the effects of WIN on GSK3-β, which were not mimicked by the CB
2 selective agonist JWH, might be explained by its interaction with CB
1 receptors in neurons.
Given that our previous work had shown that cannabinoids were preventive against the Aβ effects, both
in vitro and
in vivo [
12,
20] we decided to start the continuous oral treatment at 7 months of age. At this time Tg APP mice do not have plaques and show normal learning and memory compared to wild type mice. Nevertheless, the treatment ended at 11 months of age when Tg APP begin to show memory disruption. According to our results the prolonged drug treatment decreased microglial activation of Tg APP mice along several inflammatory mediators, which were increased. However, ageing alters microglial responsiveness (eg to Aβ production and deposition), which is highly dynamic and context dependent [
63]. Therefore a potential caveat of our results is that they may not be applicable to aged pathological microglia as occurs in severe AD. However, a preventive treatment at very early stages of the disease may be feasible and beneficial as has been shown with the anti-inflammatory trifusal, both in amnestic mild cognitively impaired patients [
64] and in Tg APP mice [
65].
Over the last decade important findings on the involvement of the endocannabinoid system in AD has been gathered. Indeed, in AD brain there is increased expression of CB
2 receptors in microglia and of fatty acid amide hydrolase, the enzyme responsible for anandamide degradation, in astrocytes around plaques [
13]. However CB
1 localization is markedly altered and its protein expression and functionality diminished [
12]. Furthermore, molecular rearrangements in different endocannabinoid system elements suggest that 2-AG signaling is increased, possibly contributing to synaptic failure in AD [
66], while anandamide levels are decreased and are inversely correlated with Aβ levels [
67]. Interestingly, the CB
2 receptor expression has been reported to be increased both in the brain of AD patients [
68] and in peripheral blood, where a significant correlation was found with the dementia score [
69]. Finally, a CB
2 PET radiotracer is accumulated in brains showing neuroinflammation (eg LPS injected and Tg APP/PS1 mice; [
70]). These latter results suggest the importance of CB
2 receptor as a biomarker of the neurologic disease, but also as a therapeutic target. CB
2 receptor increased expression in AD appears to be a consequence of microglia activation, but more importantly they render microglia susceptible to cannabinoid modulation, decreasing the generation cytotoxic molecules and inhibiting microglial activation, while promoting its migratory activity [
10,
11,
20].
Methods
Animals and treatments
Tg APP transgenic mice were obtained via heterozygous breeding of mice expressing the 695 aa long isoform of the human APP containing a double mutation Lys 670-Asn, Met 671-Leu [
52] (swedish mutation) under transcriptional control of the hamster prion promoter on a C57/BL6 breeding background. Male Tg APP and wild type littermates, used as controls, were 7 months age at the beginning of the experiments. Mice were group-housed (4-5 animals per cage) with a 12:12 h light/dark cycle and with
ad libitum access to food and water. All of the experiments were performed according to ethical regulations on the use and welfare of experimental animals of the European Union and the Spanish Ministry of Agriculture, and the procedures were approved by the bioethical committee of the CSIC.
WIN 55,212-2 (WIN) and JWH-133 (JWH) were administered in the drinking water at a dose of 0.2 mg/kg/day using ethanol (0.1%) as vehicle. The amount of water drank by the animals was assessed every other day and the treatment was adjusted to their weight. There was no difference in the body weight or the ingested water between groups, all along the experiment, discarding a possible reinforcing effect of cannabinoids.
Animals were sacrificed by cervical dislocation followed by decapitation at 11 months of age. The brain was saggitally divided. One hemisphere was rapidly dissected on a cold plate, frozen on dry ice and stored at -80°C until assayed. The other hemisphere was immersion fixed in PF 4% in PB 0.1 M for 24 h, cryoprotected in sucrose 15% (24 h) and 30% (24 h) in PB, snap frozen in hexane (-60°C) and stored at -20°C until cut with a sliding microtome.
Novel object recognition test
The arena measured 40 × 40 cm, surrounded by 30-cm-high perimeter black walls, that was located in an isolated room that was novel to the animals. The floor of the arena was covered with used sawdust. The arena was monitored by a video-camera located above the arena. The procedure consisted in three visits to the arena in subsequent days. The first day mice were placed into the empty arena for 15 min (habituation). The second day they were allowed to explore two identical objects during two 10 min trials 5 min apart (training). On the third day (test), one of the objects was changed by a novel one, with different shape and color, and the mice explored the arena for 10 min. Data collection was carried out by the Ethovision software (Noldus, The Netherlands) and exploring was defined as "directing the nose at a distance equal to or less than 3 cm from the object or touching it with the nose". The time spent exploring the familiar object and the new object was expressed as a percentage. Objects were cleaned before every exposure with acetic acid 0.1% to prevent any olfactory clues. Experiments were performed at the same time of the day (9.00-14.00 h).
18Fdeoxyglucose (18FDG) Positron Emission Tomography (PET)
Fasted mice were anesthetized with isofluorane (2%) and injected (ip) with
18FDG (11,1 MBq or 300 μCi/200 μl saline, PET Technologic Institute, Madrid). Thirty min later
18FDG uptake images of each mouse were acquired for 30 min by PET imaging (Albira PET, 8 detectors, Gem-Imaging, Spain; [
71]). The regions of interest were previously delineated in magnetic resonance (MR) T2-weighted images (Bruker Biospin, Germany) of each animal. Quantification of the metabolic activity was performed by co-registering the PET images of the brains to their own MR image as described by [
72]. In our case, the field of view (FOV) of the PET scanner is 80 × 80 × 40 mm and the number of pixels of the reconstructed tomographic image is 160 × 160 × 80 pixels, being the voxel size 0.5 mm
3. Co-registration of the PET image to the MRI, leads to a reduction of the pixel size to 0.2 mm
3, given the trilinear interpolation done by the PMOD software (PMOD Technologies, version 2.9, Switzerland). The
18FDG uptake of the different brain areas were normalized to the
18FDG uptake in the cerebellum (considered as reference region).
Immunohistochemistry and image analysis
Immunostaining was performed on floating sections (35 μm) as described previously [
12]. In brief, following several washes with PBS, the endogenous peroxidase was blocked (3% hydrogen peroxide in methanol), washed again, and incubated for 90 min in PB containing 0.2% Triton × 100 and 10% normal goat serum. Sections were incubated with the different antibodies in PB containing 0.2% Triton × 100 and 1% normal goat serum overnight at 4°C. Dilutions of antibodies were as follows: anti-GFAP (1:1500, Sigma); anti-Iba-1 (1:1000, WAKO) (additional file
2). Development was conducted by the ABC method (Pierce, Rockford, IL), and immunoreactivity was visualized by 3,3-diaminobenzidine oxidation as chromogen, with or without nickel enhancement. Images were acquired with Zeiss Axiocam high resolution digital color camera, using the same settings and the segmentation parameters (MCID software, InterFocus Imaging, UK) were constant for a given marker and experiment. The mean value for each animal per region results from the analysis of 5-6 sections.
Aβ levels
Aβ measurements were performed by two ELISA kits, one for each fragment (Aβ1-40 and Aβ1-42), from Biosource following the manufacturer instructions. The samples were sonicated (5 sec) in 10 vol of protein lysis buffer containing protease inhibitors (see Western blotting for details). The lysate was centrifuged (18,000 × g, for 10 min at 4°C). The supernatant was considered soluble and the pellets were further extracted by sonicating with formic acid and centrifuged. Prior to the Elisa the unsoluble samples were diluted 3 times with Tris 1 M, pH 10, while the soluble samples were diluted 5 times in Elisa buffer. The results were expressed as pg/mg of protein measured by the Bradford method, using BSA as standard.
Aβ transport
A double-chamber choroid plexus epithelial cell culture system mimicking the blood-cerebrospinal fluid (CSF) interface was used for
in vitro studies, as previously described [
59]. After seeding, the cells were incubated for 24 h and thereafter Aβ
1-40 (5 μg/ml) was added to the lower chamber in the absence or presence of the cannabinoid agonists (500 nM). At different time points the medium was collected from the upper chamber, and the Aβ
1-40 content was determined by immunoblotting. In other experiments Aβ
1-40 levels were assessed by selective Elisa kits (Biosource) as described above.
Western blotting
Western blot was performed as described previously [
61]. In brief, tissues were sonicated in lysis buffer, samples were centrifuged at high speed for 10 min, and supernatants were collected. Total protein was assessed by the Bio-Rad (Hercules, CA) protein assay. An aliquot of each sample (40 μg of protein) was separated by SDS-PAGE (10%), and proteins were transferred from the gels onto nitrocellulose membranes. The blots were blocked with 1% defatted dry milk for 1 h at room temperature and incubated overnight at 4°C with the following antibodies: anti-GFAP (1:10.000, DAKO), anti-CB
2 (1:10.000, Affinity Bioreagents); anti-COX2 (1:100, Abcam); anti-p-GSK3β (1:5000, BD); anti-GSK3β (1:1.500, Cell Signaling) (additional file
2). Finally, samples were subjected to enhanced chemiluminescence and densitometric analysis. Band densitometric analysis was performed by Quantity One quantitation software (version 5.0; Bio-Rad) from film exposures; the background was subtracted, and the optical density percentage was obtained considering 100% the control samples within the same film. Tubulin was used as loading control. Every membrane contained samples from each treatment group, for comparison purposes.
The specificity of the CB
2 antibodies used (additional file
2) was assessed by preincubating with the human antigenic peptide (2 μ/ml overnight at 4°C under agitation), as stated in additional file
2, before its use in Western blotting, which resulted in blockade of the immunoreactive signal (see additional file
3).
Analysis of mRNA levels by quantitative real-time PCR
Total RNA from cortex was extracted using TRIzol reagent according to the manufacturer's instructions (Invitrogen). To avoid interference with potential genomic DNA amplification, we treated 1 μg of total RNA with 1 μl DNAse I (Invitrogen) plus 1 μl of 10× Buffer (Invitrogen). The samples were incubated at RT for 15 min. EDTA (25 mM) was added to the mixture and the samples were incubated at 65°C for 15 min to heat inactivate the DNAse I. For cDNA synthesis a total of 1 μg of RNA from the different samples were reverse-transcribed for 75 min at 42°C using 5 U of avian myeloblastosis virus reverse transcriptase (Promega) in the presence of 20 U of RNasin (Promega). The real-time PCR reaction was performed in 25 μl using the fluorescent dye SYBR Green Master mix (Applied Biosystems) and a mixture of 5 pmol of reverse and forward primers. The primers used were for TNF-α forward primer 5' CATCTTCTCAAAATTCGAGTGACAA 3' and reverse primer 5' TGGGAGTAGACAAGGTACAACCC 3' and for IL-6 forward primer 5' GAGGATACCACTCCCAACAGACC 3' and reverse primer 5' AAGTGCATCATCGTTGTTCATACA 3'. Quantification was performed on an ABI PRISM 7900 sequence detection system (Applied Biosystems). PCR cycles proceeded as follows: initial denaturation for 10 min at 95°C, then 40 cycles of denaturation (15 sec, 95°C), annealing (30 sec, 60°C), and extension (30 sec, 60°C). The melting-curve analysis showed the specificity of the amplifications. Threshold cycle, which inversely correlates with the target mRNA level, was measured as the cycle number at which the reporter fluorescent emission appears above the background threshold (data not shown). Data analysis is based on the ΔCT method with normalization of raw data to a house-keeping gene (β-actin). All of the PCRs were performed in triplicate.
Statistical analysis
Statistical significance analysis was assessed by using one-way or two-way analysis of variance (ANOVA) followed by unpaired Student's t test (version 5.0, Prism software, GraphPad, USA). A value of p < 0.05 was considered significant.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
AMM-M carried out the mice treatment, the behavioural experiments, Western blotting, ELISA studies ex vivo, the molecular genetic studies, and helped to draft the manuscript. BB and MLC performed the immunohistochemical studies. NI and AC assessed qPCR experiments and Western blotting. LGG, MD and MAP designed, carried out and analyzed the PET studies. CS and EC designed and conducted the transport experiments in choroid plexus cell monolayers, including the ELISAs assays. MLC conceived of the study, participated in its design and coordination and completed the manuscript. All authors read and approved the final manuscript.