Background
More than 80 % of patients with metastatic castrate-resistant prostate cancer (mCRPC) present skeletal metastases, which invariably lead to an incurable disease for which we only have treatments that become palliative in nature [
1,
2]. Thus, the identification of gene signatures pertaining to prostate cancer (PCa) bone metastasis is fundamental to the development of novel therapeutic targets and/or the identification of prognostic or predictive biomarkers.
The vast majority of gene profile analyses using biopsies from PCa patients have been performed in primary tumors or metastatic lesions other than bone [
3‐
5], which might not provide clues about gene transcriptional changes occurring in skeletal metastasis. Although gene analysis of bone marrow core biopsies (BMBxs) would be of importance to identify the genetic make-up of PCa cells that colonize and interact with the bone microenvironment, BMBxs are not routinely performed in mCRPC patients due to the time-consuming and invasive nature of the procedure. Furthermore, in most cases, the combination of imaging studies and clinical information has proven to provide diagnostic accuracy for the assessment of suspected bone metastases [
6]. In contrast, circulating tumor cells (CTCs) can be obtained repeatedly and non-invasively through routine blood draws, and isolated through different techniques utilizing cell-surface antigens, or other physical, and/or biological properties of cancer cells [
7‐
9].
CTCs are rare cancer cells transported through the peripheral circulation. In localized, non-metastatic cancers, CTCs are thought to emanate from primary tumors. CTCs may also be released from metastatic lesions and found in peripheral blood of patients with advanced cancer, thus providing an opportunity for “liquid biopsy” that may offer information on the evolution of the disease during treatment [
9,
10]. The assessment of CTC numbers using the CellSearch
® platform has been validated as a tool of clinical utility to monitor treatment response and predict survival in mCRPC patients [
11].
Previous studies by others have demonstrated clearly the capacity of gene expression analyses of RNA obtained in large amounts from bone metastases derived from rapid autopsies of PCa patients [
12,
13]. Here, we wished to determine the feasibility of gene expression analysis of both CTCs and BMBxs in living mCRPC patients with bone scan evidence of skeletal metastasis. Since CTCs in mCRPC patients are likely to derive from bone metastatic deposits, we also aimed to explore similarities/differences in gene expression in both CTCs and BMBxs obtained from the same patients.
Methods
Cell culture
PC3 and LNCaP PCa cells were obtained from ATCC (Manassas, VA) and provided by Dr. Leland Chung (Cedars-Sinai Medical Center, Los Angeles, CA), respectively. Both cell lines were grown in RPMI-1640 with 10 % heat-inactivated fetal bovine serum (FBS). Authentication of the human cell lines used here was verified through short tandem repeat profiling by the Research Technology Support Facility of Michigan State University.
Cell spike-in experiments
For validation studies, 80 % confluent PC3 and LNCaP monolayers were trypsinized, and diluted in complete culture medium to adjust their cell density to 50 cells/mL. Cell suspensions (100 μL) were plated into the wells of 96-well cell culture plates. Twenty-four hours later, cells in all wells were counted under the microscope, and those with exactly five cells were trypsinized and added to 7.5 mL of blood from healthy volunteer donors drawn into CellSave® preservative tubes (Janssen Diagnostics, LLC). CellSave® tubes containing blood spiked with cultured PCa cells, as well as matched non-spiked blood samples serving as negative controls, were processed in triplicate using the semiautomated CellSearch® Circulating Epithelial Cell Kit (Janssen) in the CellTracks® Autoprep® system (Janssen) for cell enumeration at the Biobanking and Correlative Sciences Core at Karmanos Cancer Institute. Briefly, epithelial cells present in peripheral blood were magnetically captured with a ferrofluid-coupled antibody targeting the epithelial cell adhesion molecule (EpCAM), then immunostained with allophycocyanin (APC)-labeled antibodies to the leukocyte marker CD45, phycoerythrin (PE)-labeled antibodies to epithelial markers cytokeratins (CKs) 8, 18, and 19, and stained with the nuclear stain 4,2-diamidino-2-phenylindole-dihydrochloride (DAPI). The sample was transferred automatically to a cartridge in a MagNest, and finally scanned with the semi-automated fluorescence optical system Cell-Tracks Analyzer II® (Janssen). Objects preselected and displayed by the system in a gallery were defined as CTCs and counted by a trained operator if they were round to oval in shape, 4 µm in size or larger, positive for the epithelial marker (CK-PE) and nuclear stain (DAPI) with at least 50 % overlap between the CK-PE-positive cytoplasm and the nucleus, and negative for the leukocyte marker (CD45-APC). In addition, 5 PC3 or LNCaP cells were spiked into 7.5 mL of blood from healthy volunteer donors drawn into fixative-free K3EDTA tubes (BD Vacutainer®, Becton–Dickinson) (three experiments performed by three different investigators), to validate the sensitivity of the RNA amplification method used by us (see description below). To this end, the spiked blood was immediately processed using the CellSearch® Profile Kit (Janssen) and the CellTracks® Autoprep® system, and then the tube employed containing a final volume of 900 µL CTC enriched sample was placed in a DynaMag™-15 magnet (Invitrogen) for 10 min. After carefully aspirating the liquid without disturbing the ferrofluid bead pellet concentrated on the tube wall, 1 mL of TRIzol® (Invitrogen) was added, and the tube vortexed to lyse cells and inactivate nucleases. The lysate was transferred to a 1.5 mL RNase-free Eppendorf tube, and stored at −80 °C until RNA isolation and antisense RNA (aRNA) amplification was performed.
Patient enrollment and eligibility
Written informed consent was obtained from 24 mCRPC patients enrolled to participate in the human protocol # 2011-060 (Principal Investigator: Dr. Michael L. Cher), and approved by Karmanos Cancer Institute and Wayne State University Institutional Review Board. Study inclusion criteria were: (a) prior diagnosis of mCRPC characterized by rising PSA level or clinical disease progression despite a castrate level of serum testosterone; (b) clinical decision to start a new anti-cancer systemic therapy, and no treatment with any investigational drug within 2 weeks prior to blood draw/tissue biopsy proposed herein; (c) metastatic deposit visible on an imaging study obtained within 8 weeks prior to initiation of new systemic therapy; (d) radiological evidence of accessibility to a metastatic deposit in bone by computed tomography (CT); (e) performance status of 0–2 by ECOG/Zubrod criteria; (f) Absolute neutrophil count ≥1500 mm
3, hemoglobin ≥9.0 g/dL, platelets ≥100,000/mm
3; (g) Prothrombin Time and Partial Thromboplastin Time should be < institutional upper limit of normal; (h) presence of one or more CTCs per 7.5 mL, assessed using the Veridex CellSearch
® Profile Kit assay, as explained above. The characteristics of the patients enrolled in this study are described in Table
1.
Table 1
Demographic and clinical parameters of evaluable mCRPC patients
Age | Median | 69 |
Range | 58–88 |
Race | White | 10 (67) |
Black | 5 (33) |
Hispanic | 0 (0) |
Asian | 0 (0) |
Gleason scorea
| | 5 (33) |
| 8–10 | 8 (53.5) |
| Not available | 2 (13.5) |
PSA (ng/mL) | Median | 70.8 |
Range | 1.9–1299 |
AP (U/L) | Median | 437.5 |
Range | 65–1224 |
Metastases | Bone only | 11 (73) |
Bone and soft tissue | 2 (13.5) |
Bone and unknownb
| 2 (13.5) |
CTC/7.5 mL | Median | 20 |
Range | 1–834 |
Blood sample processing
Blood from each patient was initially collected in CellSave® preservative tubes and processed for CTC enumeration as described above. Patients who were positive for CTCs were subjected to a new blood draw into K3EDTA anticoagulant tubes used in the CellSearch® Profile Kit, for CTC enrichment and RNA extraction as described above. The TRIzol® lysate obtained was transferred to a 1.5 mL RNase-free Eppendorf tube, and stored at -80 °C until needed.
Procurement and processing of tumor tissue from bone metastases
On the same day blood was drawn for CTC enrichment and RNA extraction, patients then underwent CT-guided BMBx using a battery-powered drill and biopsy needle set. Four to six BMBxs were obtained from the iliac bone of each patient. One of the cores was placed in an RNase-free Eppendorf tube and flash frozen and transported in liquid nitrogen for storage at −80 °C until processing. The remaining BMBxs were fixed for 24 h in 4 % paraformaldehyde in diethylpyrocarbonate (DEPC)-treated PBS, and decalcified in 10 % EDTA in autoclaved DEPC-treated water, pH 7.0, with agitation at room temperature for 3 days. After decalcification, each BMBx was progressively dehydrated with increasing concentrations of ethanol, and immediately paraffin-embedded using Precision Cut Paraffin (Thermo Scientific). All aqueous solutions were prepared using DEPC-treated water.
Laser capture microdissection
Two adjacent 5-µm sections were obtained from the formalin-fixed paraffin-embedded (FFPE) BMBxs, using at all times RNase-free technique. Immunohistochemistry (IHC) for cytokeratin was performed on one of the slides for identification of PCa cells, as previously described [
14,
15], as PCa cells are the only cytokeratin-positive cells expected to be found within the BMBx. The adjacent tissue section was mounted onto an RNase-free polyethylene naphthalate (PEN) membrane glass slide (Arcturus), which was previously sprayed with RNase AWAY™ (Thermo Scientific), washed twice with DEPC-treated, nuclease-free water (Fisher Scientific), and then exposed to UV for 30 min under a laminar flow hood to render the PEN membrane more hydrophilic and improve adherence of the specimen. After air drying for about 2 h under a laminar flow hood, the section mounted on the slide was deparaffinized, hydrated with decreasing graded alcohols made with DEPC-treated water, and rapidly stained with Harris hematoxylin and alcoholic Eosin Y solution (H&E), washed twice with 100 % ethanol and xylene, then held in xylene until initiation of the laser capture microdissection (LCM) session. The H&E-stained slide was air dried and loaded onto the ArcturusXT™ LCM System. Metastatic lesions identified in the FFPE sample were excised using both the infrared (IR) and ultraviolet (UV) microdissection lasers, and collected on individual CapSure
® Macro LCM Caps (Arcturus). When needed, the adjacent section immunostained for cytokeratin was used for guidance during the LCM session to identify epithelial (PCa) cells within the bone marrow. Tumor material was deemed to be inadequate for LCM and RNA collection if the area identified as tumor was smaller than 9000 µm
2, with 150 PCa cells on average. To collect total RNA from the microdissected tissue, the CapSure
® Macro LCM Cap containing the captured material was immediately placed into a 0.5 mL RNase-free microcentrifuge tube filled with 50 µL of TRIzol
® reagent, vortexed for 5 min to lyse the cells, and the lysate obtained stored at −80 °C until needed.
RNA isolation and amplification of small amounts of RNA
Cultured PCa cells and CTCs were lysed with TRIzol
® reagent, as described above. Flash frozen BMBxs were placed in pre-chilled microtubes containing 2.8 mm ceramic beads and TRIzol
® reagent using a Precellys
®24 homogenizer (Peqlab LLC), 1 cycle × 30 s at 6000 rpm at 4 °C, similarly as described by others [
16]. High-quality total RNA (DNA-free) was purified from cultured cells, CTCs, LCM, and frozen BMBxs lysed with TRIzol
® using Direct-zol™ RNA MiniPrep (Zymo Research), as per manufacturer’s instructions. For gene analysis of CTCs enriched from patients’ blood, spiked-in cultured cells, or tumor cells metastatic to bone recovered by LCM, RNAs were amplified using an antisense mRNA (aRNA) amplification system based on the Eberwine’s procedure [
17], using the MessageAmp™ II aRNA Amplification Kit (Invitrogen). The protocol was performed as recommended by the manufacturer, except for the replacement of ArrayScript™ RT by Superscript
® VILO™ Master Mix (Invitrogen) and the replacement of 10 × First Strand buffer from MessageAmp™ II aRNA Amplification Kit (Invitrogen) by 5 × First Strand buffer from Superscript
® II Reverse Transcriptase (Invitrogen). This was done to increase the reverse transcription (RT) of total RNA into a first strand of complimentary DNA (cDNA). SuperScript
® VILO™ Master Mix contains a recombinant ribonuclease inhibitor and SuperScript
® III RT, which is among the best performing reverse transcriptases in terms of reproducibility and sensitivity for low copy RNA levels [
18]. After RNase treatment, a second strand cDNA is generated by DNA polymerase. The resulting double-stranded cDNA was then used as a template for T7-RNA polymerase for in vitro transcription (IVT) into aRNA (also known as complimentary RNA, cRNA) and amplification. The procedure was repeated in a second round of amplification when additional aRNA yield was needed. After IVT, double-stranded cDNAs were removed by treatment with DNase I, and the amplified RNA was purified.
Concentrations of total RNA and amplified aRNA obtained from cells spiked in blood, as well as from amplified aRNA obtained from CTCs and flash frozen or FFPE BMBxs, were quantified by absorbance measurements using an Epoch™ Microplate Spectrophotometer for micro-volume analysis (BioTek). Purity of total RNA and amplified aRNA was assessed through the ratio of the absorbance of the samples at 260 and 280 nm (A260/A280).
Assessment of amplified aRNA integrity
Integrity of mRNA is usually assessed by the ratio of the 28S:18S rRNA species shown in denaturing agarose gel electrophoresis, based on the assumption that the quality of rRNA (more than 80 % of total RNA) reflects that of underlying mRNA. However, this approach cannot be used to assess the integrity of amplified aRNA, which does not contain rRNA and derives from minute amounts of total RNA. Therefore, we assessed the integrity of aRNA with RT-PCR (see below) using two sets of primers to probe different positions (5′ end, middle, and 3′ end regions) of
EpCAM and
GAPDH transcripts, by verifying the presence of each respective amplicon on agarose gels (Fig.
2a), following a strategy similar to that described by Nolan [
19].
Gene expression analysis
Total RNA or amplified aRNA was reverse transcribed into cDNA using iScript™ cDNA synthesis kit (Bio-Rad) according to manufacturer’s protocol. For RT-PCR, resultant cDNAs were used as a template in a PCR reaction using DreamTaq DNA polymerase (Life Technologies). Forward and reverse primers used are listed in Table
2. The following amplification conditions were used: an initial denaturation at 95 °C for 3 min, followed by 35–40 cycles (except for GAPDH, 25 cycles) of 95 °C for 30 s, 52–55 °C for 30 s and 72 °C for 1 min, followed by a final extension 72 °C for 5 min. PCR products were resolved on a 2 % agarose gel and visualized by ethidium bromide staining. DNA bands were visualized using a ChemiDoc XRS gel documentation system (Bio-Rad).
Table 2
Primer pairs used for RT-PCR and RT-qPCR studies
BMP7
| NM 001719 | FWD: TACGCCGCCTACTACTGTGA REV: CCGGACCACCATGTTTCTGTA | 219 |
CD45
| NM 002838 | FWD: AGCACCTACCCTGCTCAGAA REV: TTCAGCCTGTTCCTTTGCTT | 159 |
5′-EpCAM
| NM 002354 | FWD: CAGGTCCTCGCGTTCGGG REV: CAGTCAGGATCATAAAGCCCATCA | 284 |
Middle EpCAM
| NM 002354 | FWD: AATGGACCTGACAGTAAATGG REV: ATCTCAGCCTTCTCATAC TT | 216 |
3′-EpCAM
| NM 002354 | FWD: TGGGGAACAACTGGATCTGG REV: GTTCCCTATGCATCTCACCCA | 227 |
5′-GAPDH
| NM 002046 | FWD: GGAAGGTGAAGGTCGGAGTC REV: CTCGCTCCTGGAAGATGGTG | 237 |
Middle GAPDH
| NM 002046 | FWD: GAGAAGGCTGGGGCTCATTT REV: AGTGATGGCATGGACTGTGG | 231 |
3′-GAPDH
| NM 002046 | FWD: AAGGTCATCCCTGAGCTGAA REV: TGACAAAGTGGTCGTTGAGG | 271 |
IL6
| NM 000600 | FWD: AATGAGGAGACTTGCCTGGTG REV: GCTGCGCAGAATGAGATGAG | 273 |
MMP14
| NM 004995 | FWD: AGTCTCCCAGAGGGTCATTCA REV: GGTCCCATGGCGTCTGAAG | 320 |
SNAI 2
| NM 003068 | FWD: CTTTTTCTTGCCCTCACTGC REV: ACAGCAGCCAGATTCCTCAT | 161 |
t-ERG
| FJ423744 | FWD: TMPRSS2_E1-TAGGCGCGAGCTAAGCAG REV: EGR_E4-GTCCATAGTCGCTGGAGGAG | 184 |
Vimentin
| NM 003380 | FWD: GAGAACTTTGCCGTTGAAGC REV: TCCAGCAGCTTCCTGTAGGT | 170 |
ZEB 1
| NM 030751 | FWD: TGCACTGAGTGTGGAAAAGC REV: TGGTGATGCTGAAAGAGACG | 237 |
For reverse transcriptase quantitative real-time quantitative PCR (RT-qPCR), the Mastercycler RealPlex2 (Eppendorf) real-time PCR system and GoTaq qPCR Master Mix (Promega) were used. Thermal cycle parameters were as follows: initial activation at 95 °C for 2 min, 40 cycles of denaturation at 95 °C for 15 s, annealing 55 °C for 15 s, and extension at 72 °C for 30 s. The mean cycle threshold (Ct) for each gene was normalized to levels of the housekeeping gene
GAPDH in the same sample. Relative fold changes in expression for each gene were calculated by the delta–delta-CT method [
20].
As a proof of concept, we selected eight genes for analysis with RT-PCR in CTCs and LCM BMBxs based on their relevance to PCa bone metastasis: (a)
EpCAM, which codes for a transmembrane epithelial glycoprotein [
21] overexpressed in adenocarcinomas [
22] and used in the CellSearch
® system to enrich CTCs via immunomagnetic separation; (b)
PSA (prostate-specific antigen), a well know biomarker for PCa screening found to be positive in mCRPC patients [
23]; (c)
BMP-
7 (bone morphogenetic protein-7), a member of the transforming growth factor-beta (TGF-β) family that is usually expressed in osteoblastic bone metastases of PCa [
24], and increased in CRPC patients [
25]; (d)
MMP-
14 (a.k.a.
MT1-
MMP), a membrane-tethered matrix metalloproteinase that we found to be expressed by PCa cells in skeletal metastases, and contribute to bone remodeling and intraosseous tumor growth [
26]; (e)
TMPRSS2-
ERG gene rearrangement due to chromosomal translocations that fuse the androgen-regulated
TMPRSS2 promoter with the ETS family transcription factor
ERG, which is expressed in about half of advanced PCas [
27‐
29] and has been associated with an increased risk death in PCa patients [
30‐
32]; (f)
IL-
6 (interleukin-6), which is highly expressed by PCa cells with aggressive phenotype [
33], and has been associated with resistance to chemotherapy in CRPC [
34] and bone remodeling in PCa bone metastases [
35,
36]; (g)
Vimentin, an intermediate filament protein expressed in mesenchymal cells frequently used as a marker of epithelial to mesenchymal transition (EMT) [
37]; and (h)
GAPDH, a housekeeping gene used as a control.
Statistical analysis
Data obtained using RT-qPCR are presented as mean values ± SD and analyzed using the ANOVA test, with p < 0.05 considered as statistically significant.
Discussion
Precise analysis of human tissue is necessary for evaluation of gene expression. In this study, we wished to develop methods of gene expression analysis of CTCs and BMBxs in patients with mCRPC. We found that LCM, in conjunction with reliable methods of gene amplification, is an option for the specific isolation and molecular analysis of small number of PCa cells present in BMBxs. In recent years, LCM systems with IR and UV lasers combined with efficient software have been developed to isolate homogeneous cells precisely identified from heterogeneous tissues based on morphological criteria, and complemented by IHC phenotyping of the cell type of interest. In these LCM systems, the low-energy IR laser is fired to adhere spots within the selected tissue area to the PEN membrane of the glass slide, while the UV rapidly and precisely cuts out the zone defined to collect it in a collection cap [
43]. In addition to RNA analysis, different types of molecular analyses can be performed on cells procured by LCM, including DNA and proteomic analyses [
44,
45].
In this exploratory study with a small cohort of mCRPC patients, we demonstrated the feasibility of amplifying aRNA for gene analysis in limited numbers of PCa cells microdissected from FFPE BMBxs. We show that using a modified Eberwine’s procedure, adequate yields of RNA can be obtained for gene expression profiling. Our results obtained under tightly controlled conditions show good quality aRNA not only in freshly isolated CTCs, but also in aRNA amplified from FFPE BMBxs despite several studies having reported RNA degradation in formalin-fixed samples [
46‐
48]. To avoid RNA degradation, we found that critical measures such as rapid processing of BMBxs after collection, preparation of all aqueous solutions using DEPC-treated water, and decontamination of all materials and surfaces with ready-to-use surfactants that remove RNA and RNases from lab equipment, are mandatory throughout the procedure. Previous studies have reported LCM and DNA sequencing from a frozen bone metastasis of a mCRPC patient [
49], or gene expression analysis of total RNA directly obtained from snap-frozen bone marrow biopsies largely replaced by tumor [
50] or frozen bone metastatic cores isolated at autopsy [
12,
13,
51,
52]. However, in addition to our earliest analysis in a few PCa bone metastasis [
53], the present study is the only report that, to the best of our knowledge, uses LCM and aRNA amplification for gene analysis of limited number of tumor cells microdissected from FFPE BMBx obtained from living mCRPC patients. In spite of better RNA recovery and quality ascribed to frozen tissue [
43,
44,
54], we found that its use as homogenate might be inadequate for gene expression analysis of PCa bone micrometastasis, due to dilution of PCa-specific genes by other genes expressed predominantly by bone cells. In that sense, the use of LCM to identify and capture precise cells from FFPE BMBxs seems to be more accurate to study gene expression after aRNA amplification. Limitations of this approach include the yield of bone biopsies (~50 %) and the need for sufficient tissue (~9000 µm
2) for LCM.
Besides the clinical utility of the CTC count to monitor treatment response and predict survival in mCRPC patients [
11], enriched CTCs can also be used for molecular studies that may provide important clues to understand the biology behind metastatic dissemination of PCa. Analysis of CTCs may also lead to the discovery of novel predictive and prognostic biomarkers or demonstrate targets for therapy. Many groups have succeeded in genomic and transcriptomic profiling of CTCs in patients with PCa [
29,
55‐
62]; however, to our knowledge, none of them have compared molecular features of CTCs with those of bone micrometastasis in mCRPC patients. Because significantly higher CTC numbers are detected in mCRPC patients with bone metastasis relative to those without bone metastatic lesions [
38], CTCs in patients are likely to derive from bone metastatic deposits. Thus, we hypothesized that gene signatures of skeletal metastasis may be mirrored in CTCs in each mCRPC patient. Our study suggests some concordance in presence or absence of gene expression in CTCs and single bone lesions of the same mCRPC patients. An obvious limitation of our study is the small sample size and the biopsy-targeting of single bone lesions; future studies with more patients and perhaps more biopsy sites in individual patients may provide additional clarification.
Data collected from autopsy studies in men who died of mCRPC have revealed substantial heterogeneity among tumor cells in bone metastases within the same patient [
63‐
65]. Therefore, we surmise that presence or absence of detectable gene expression in CTCs, rather than gene expression levels, may provide a more clinically relevant overview of the genomic landscape in each mCRPC patient. Detectable gene expression in CTCs may suggest a druggable target; however, this result may ultimately be unreliable due to heterogeneity of target gene expression among separate metastatic deposits within individual patients. Similarly, absence of target gene expression in CTCs may not rule out target gene expression in some metastatic deposits. Therefore, this exploratory analysis raises concerns about relying on CTCs to predict response to therapy.
In this study we used CellSearch
®, an EpCAM-based platform utilized for capturing of epithelial tumor cells from peripheral blood of mCRPC patients. Like other CTC-enriching technologies that rely on the expression of epithelial markers, the CellSearch
® system does not have the capacity to isolate CTCs that might have gone through EMT. However, we found that the genes that code for the epithelial marker EpCAM and the mesenchymal marker vimentin were co-expressed in many of our patients’ CTC samples, suggesting a partial EMT. These results are in agreement with the findings of other groups that reported expression of EMT markers in EpCAM-positive CTCs [
66‐
68]. We also found
Vimentin to be expressed by most of the pure PCa tissues microdissected from BMBx. Our results are supported by IHC studies by Sethi et al. that show vimentin overexpression at the invasive front of bone metastases of PCa patients and E-cadherin within the center of the lesion [
69], and those of Bryden et al. who reported lower E-cadherin expression in poorly differentiated bone metastases than in more differentiated ones [
70]. The expression of mesenchymal markers in PCa metastatic to bone could be ascribed to osseous factors that offer a selective growth advantage for tumor cells with a mesenchymal phenotype, as opposed to other tissues (e.g., lung) that promote mesenchymal-to-epithelial transition in colonizing cancer cells [
71,
72].
Authors’ contributions
RDB and H-RCK conceived and designed the experiments. WJC, DSMO, AJN, and LEM performed the experiments. HAD performed image-guided bone marrow core biopsies. RDB, H-RCK, MLC, and EH analyzed the data. EH and MLC contributed patients’ biospecimens. RDB wrote the paper. All authors read and approved the final manuscript.