Skip to main content
Erschienen in: Diagnostic Pathology 1/2021

Open Access 01.12.2021 | Research

miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p are sensitive biomarkers to diagnose sudden cardiac death

verfasst von: Fengping Yan, Yuanyuan Chen, Xing Ye, Fu Zhang, Shiquan Wang, Le Zhang, Xiaoting Luo

Erschienen in: Diagnostic Pathology | Ausgabe 1/2021

Abstract

Background

Sudden cardiac death (SCD) remains a great health threat and diagnostic challenge, especially those cases without positive autopsy findings. Molecular biomarkers have been urgently needed for the diagnosis of SCD displaying negative autopsy results. Due to their nature of stability, microRNAs (miRNAs) have emerged as promising diagnostic biomarkers for cardiovascular diseases.

Methods

This study investigated whether specific cardio-miRNAs (miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p) could serve as potential biomarkers for the diagnosis of SCD. Thirty-four SCD cases were selected, 18 categorized as SCD with negative autopsy (SCD-negative autopsy) findings and 16 as SCD with positive autopsy (SCD-positive autopsy) findings such as coronary atherosclerosis and gross myocardial scar. Carbon monoxide (CO) intoxication (n = 14) and fatal injury death (n = 14) that displayed no pathological changes of myocardium were selected as control group, respectively. Histological analyses were performed to reveal the pathological changes and real-time quantitative polymerase chain reaction (RT-qPCR) was used to determine the expression of those miRNAs.

Results

It showed that heart samples from the SCD-negative autopsy group displayed no remarkable difference with regard to the expression of cleaved-caspase3, CD31, and CD68 and the extent of fibrotic tissue accumulation when compared with control samples. The four cardio-miRNAs were significantly up-regulated in the SCD samples as compared with control. When discriminating SCD from controls, receiver operating characteristic (ROC) curve analysis revealed that the areas under the curve (AUC) of these 4 miRNAs were from 0.7839 to 0.9043 with sensitivity of 64.71–97.06% and specificity of 70–100%. Moreover, when discriminating the specific causes of SCD, the four miRNA expressions increased in the heart from the SCD-negative autopsy group as relative to that from the SCD-positive autopsy group, and a combination of two miRNAs presented higher diagnostic value (AUC = 0.7407–0.8667).

Conclusion

miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p may serve as independent diagnostic biomarkers for SCD, and a combination of two of these miRNAs could further discriminate detailed causes of SCD.
Hinweise
Fengping Yan and Yuanyuan Chen contributed equally to this work.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Abkürzungen
SCD
Sudden cardiac deaths
AMI
Acute myocardial infarction
SCD-positive autopsy
Sudden cardiac death with positive autopsy
SCD-negative autopsy
Sudden cardiac death with negative autopsy
CO
Carbon monoxide
ROC
Receiver operating characteristic
AUC
Area under the curve
CI
Confidence interval
miRNA
MicroRNA
OR
Odds ratio
H&E
Hematoxylin & Eosin
PSR
PicroSirius Red
FFPE
Formalin-fixed paraffin-embedded
IHC
Immunohistochemistry
IHC
Horseradish peroxide
LB
Lower bound
UB
Upper bound

Background

Heart serves as a biological pump that circulates blood throughout our bodies and thus supplying us with oxygen and nutrients. Irregular cardiac activities can restrict blood supply and lead to sudden cardiac death (SCD) [1], a condition that is defined as autopsy identification of a cardiac or vascular anomaly as the probable cause of death for seemingly healthy decedents [2]. SCD is one of the major causes of natural death, causing approximately 1 million of adult deaths in China each year, and remains one of the most challenging tasks in cardiology [3]. Coronary artery diseases closely associate with the high incidence of SCD cases, particularly myocardial infarction (MI) [4]. Acute MI (AMI) is defined as myocardial necrosis in a clinical setting consistent with acute myocardial ischemia [5]. AMI is a specific cause of SCD that often claims deaths in a short period. Unfortunately, deaths from AMI often show negative autopsy findings, and it is not easy to accurately diagnose with the current histopathology techniques. Moreover, data suggested that though implantable cardioverter defibrillators (ICD) have being used to prevent SCD in individuals with existing conditions of cardiomyopathy and inherited arrhythmias [6], their survival benefits are limited as only 20–30% even under appropriate therapy [7]. In addition, albeit left ventricular systolic dysfunction and the severity of heart failure symptoms being predictors of SCD [8], a considerable number of SCD events do not have a pre-existing history of depressed ejection fraction or a clinical history of heart failure [9]. Furthermore, some SCD cases cannot be explained even after systemic autopsy and histological examination. These cases have been postulated to die largely from AMI without grossly observable pathology [10]. Therefore, it is an imperative to find sensitive biomarkers that could be used for detection of SCD, particularly SCD with negative autopsy (SCD-negative autopsy) findings.
Currently, mutations of cardiac-related genes have been implicated in the pathogenesis of SCD, such as MYBPC3 [11], ACE [12] and PKP2 [13] . For example, the ACE DD genotype was associated with a 3.35-fold higher risk of AMI, and a significantly higher risk of SCD (odds ratio (OR) = 6.484, 95% confidence interval (CI): 1.036–40.598, p = 0.046) [12] . Inflammation is also reported to play a pivotal role in the pathogenesis of atherosclerosis and cardiovascular disease, with c-reactive protein (CRP) emerging as inflammatory biomarker in AMI [14].
In addition to the above macromolecules, noncoding RNAs have recently received great attention for their potential as diagnostic biomarkers [15]. MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression at a post-transcriptional level by repressing messenger RNA (mRNA) translation mainly via binding at the complementary 3′-untranslated region [16]. It has been widely recognized that miRNAs can serve as vital players in many biological processes, especially in the cardiovascular diseases [17]. Studies have shown that aberrant miRNAs expression closely related to AMI [18], hypertension [19], atherosclerosis [20], heart failure [21] and arrhythmias [22]. miR-223 enhanced cardiac fibroblasts proliferation, migration, and differentiation, which led to cardiac fibrosis partially via the involvement of RASA1 [23]. miR-133a plays an important role in atherosclerosis by attenuating lipid accumulation via TR4-CD36 pathway in macrophages [24]. miRNA-499 levels were found to be linearly proportional to myocardial damage, with close relationship with AMI [25]. Our previous work has identified miRNA-3113-5p as a novel cardio-miRNA that is significantly increased after cardiac ischemia-reperfusion (I/R) injury in cardiac and circulating levels and miRNA-3113-5p might serve as a stable marker for diagnosis of cardiac I/R injury [26]. All these miRNAs have been identified as originating from the heart or being heart-resided, making them possible candidates for the diagnostic biomarkers of cardiovascular diseases. However, despite a large number of studies in identifying biomarkers to improve SCD diagnostic efficiency, few biomarkers have progressed to clinical use for SCD.
Given miRNAs’ stability and potential role in various cardiovascular events such as SCD, the aim of the present study is to investigate the value of four cardio-miRNAs (miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p) in discriminating SCD from controls. Our data showed that each of these miRNAs had considerable sensitivity when discriminating the SCD from non-cardiac deaths, and a combination of two of these miRNAs could further efficiently discriminate detailed causes of SCD.

Methods

Human heart samples

For the purpose of this study, we collected four categories of human heart samples that were autopsied at the Department of Forensic Medicine, School of Basic Medical Sciences, Gannan Medical University over the period 2012–2019. A total of 34 cases of subjects who died from SCD were selected. These cases included 18 of SCD-negative autopsy that presented none notable heart changes at autopsy and 16 of SCD with evidence of heart dysfunction (SCD-positive autopsy). The causes of SCD were made after systemic autopsy. SCD-negative autopsy was defined as sudden deaths without gross heart pathology, with or without histological evidence of early myocardial ischemia (i.e. wavy fiber, hyperesonophilia of cardiomyocytes, and contraction band necrosis). SCD-positive autopsy was defined as sudden deaths in clinic plus severe coronary artery stenosis at autopsy, often with gross or microscopic scarring within myocardium. In addition, 14 cases of fatal injury and 14 cases of carbon monoxide (CO) intoxication were selected as the year-matched control cases. In detail, the heart specimens from fatal injury served as negative control due to none myocardial ischemia in such conditions, and the heart specimens from acute CO intoxication were assigned as positive control due to the global, but not heart-restricted, deficiency of oxygen in such circumstances. Patients who had pre-operative chemo- or radiotherapy history were excluded. Any case with heart implantation was also excluded. All of these cases undergone autopsy examination and were also excluded from influence of other potential substances such as alcohol, illicit drugs, or psychoactive drugs. Detailed demographic and case information regarding the four categories of cases were documented in Table 1. Detailed heart pathology of the four groups of cases were recorded in Table 2. The use of human heart samples for the purpose of research was approved by the Ethical Review Board at the School of Basic Medical Sciences, Gannan Medical University.
Table 1
Basic information regarding the human fatal cases
Cause of death
Group
n
Male/female
Age
(years)
Postmortem
Interval
(h)
heart weight
(g)
Survival time
(h)
CO intoxication
Positive control
14
7/7
30.29 ± 3.11
7.29 ± 1.92
298.9 ± 32.71
1.58 ± 0.57
Fatal injury
Negative control
14
9/5
45.00 ± 4.01**
8.07 ± 1.96
312.5 ± 20.18
1.41 ± 0.65
SCD-positive autopsy
SCD
16
14/2
62.69 ± 3.06***##
3.75 ± 0.66#
455.6 ± 10.49***###
1.99 ± 0.93
SCD-negative autopsy
SCD
18
14/4
42.11 ± 3.08*&&&
5.50 ± 1.27
377.8 ± 27.32&
1.89 ± 0.58
CO Carbon monoxide. SCD Sudden cardiac death. SCD-positive autopsy, sudden cardiac death with positive autopsy (with evidence of heart dysfunction) findings. SCD-negative autopsy, sudden cardiac death with negative autopsy (without gross heart changes at autopsy) findings
*p < 0.05, **p < 0.01, and ***p < 0.001 vs. CO intoxication. #p < 0.05, ##p < 0.01, and ###p < 0.001 vs. Fatal injury. &p < 0.05 and &&&p < 0.001 vs. SCD-positive autopsy
Table 2
Heart pathology in the SCD-negative autopsy, SCD-positive autopsy, and control groups (CO intoxication and fatal injury)
Characteristics
CO intoxication
Fatal injury
SCD-negative autopsy
SCD-positive autopsy
Total cases
n = 14
n = 14
n = 18
n = 16
Heart pathology
No evident changes
No evident changes
● 38.9% (7 cases) with both interstitial edema, wavy fibers, and hypereosinophilia of cardiomyocytes;
● 33.3% (6 cases) with only interstitial edema and patchy hypereosinophilic cardiomyocytes;
● 16.7% (3 cases) with interstitial edema and some slightly wavy fibers;
● 11.1% (2 cases) without evident gross or histological changes.
● 56.2% (9 cases) with coronary stenosis (50–75% stenosis), calcification and myocardial fibrosis;
● 43.8% (7 cases) with coronary stenosis (> 75% stenosis), severe myocardial fibrosis and disorder.

Histological evaluation

All histological evaluation was performed using the human heart samples dissected from the apex of each heart. Due to difficulty in obtaining fresh surgical heart samples, we used the autoptic formalin-fixed paraffin-embedded (FFPE) samples for the purpose of this study. Unlike mRNAs or proteins that are prone to degradation and chemical modification, miRNAs are very small in size (~ 22 nt), less likely to be degraded, and easier to recover from FFPE samples, all of which confer to miRNAs high forensic relevance [27]. The extraction of miRNAs from autoptic FFPE samples was commonly documented in publications [28]. After histological staining, independent pathologists were recruited to review the Hematoxylin & Eosin (H&E) staining sections and PicroSirius Red (PSR) staining sections using a multi-head microscope to result in consensus.
For the H&E staining, human heart tissues were immediately fixed in 4% paraformaldehyde for 24 h, followed by embedding in paraffin. Tissues were then sliced into 5 μm-thick heart slices. Then the slices were dewaxed and dehydrated in a gradient alcohol. Slices were then stained with hematoxylin solution for 10 min at room temperature and incubated in 1% hydrochloric-alcohol solution. Then, slices were washed using tap water, stained with eosin solution for 5 min, and separated by 75, 85, 90, 95 and 100% alcohol solutions for 2 min, respectively. Next, the slices were dried and sealed with neutral gums. After H&E staining, the morphological changes were observed and photographed under an optical microscope (Olympus, Tokyo, Japan).
For the PSR staining, human heart slices were deparaffinized to water and then immersed in 0.1% Sirius red staining solution dissolved in picric acid for 1 h. Then slices were washed in acidified water containing 1.5% hydrogen chloride, dehydrated and mounted. Collagen and non-collagen components were red- and orange-stained, respectively.

Immunohistochemistry (IHC) staining

Heart slices from the four categories were also subject to IHC analysis. Briefly, the slides were incubated in 3% H2O2 solution for 10 min and antigen retrieval was performed by steam heating in 10 mM citrate buffer (pH 6.0) for 30 min. After epitope recovery, the slides were then treated with 10% of normal goat serum for 60 min, followed by incubation with active caspase 3 antibody (1:500, Cell Signaling Technology, Catlog #9664, MA, USA), CD31 antibody (1:1000, Cell Signaling Technology, Catlog #3528), and CD68 antibody (1:500, Cell Signaling Technology, Catlog #76437) incubation overnight at 4 °C. The slides were washed and incubated with secondary horseradish peroxide (HRP)-linked secondary antibody (Vector Laboratories, MN, USA) at 1:500 dilutions for 1 h. The samples were treated with the chromogen DAB for antigen detection and the final counterstaining was performed with hematoxylin.

RNA extraction and reverse transcription

All paraffin was removed from the FFPE heart sections by treating with Deparaffinization Solution. The extraction of miRNAs from FFPE tissues was performed using a commercial miRNeasy FFPE kit (Qiagen, Catlog #217504, Hilden, Germany). Briefly, samples were incubated by heat treatment in an optimized lysis buffer, which contains proteinase K, to release RNAs from the sections. Supernatant was collected and treated with a DNase, followed by buffer RBC and ethanol treatments. The cleaned samples were then applied to an RNeasy MiniElute spin column, where the total RNAs including miRNAs, bound to the membrane and contaminants were efficiently washed away. Total RNAs including miRNAs were then eluted in a minimum of 14 μL of RNase-free water. Reverse transcription of the total RNA was performed using a Mir-X miRNA First-Strand Synthesis Kit (Takara, Tokyo, Japan) for RT-qPCR of miRNA. The synthesized cDNA was stored at − 80 °C for later use.

Real-time quantitative polymerase chain reaction (RT-qPCR)

QuantiFast Multiplex RT-PCR Kit (Qiagen) was used for RT-qPCR analysis. According to the kit instructions, an aliquot of 25 μL reaction system was mixed and amplified using the Applied Biosystem 7500 fluorescence quantitative PCR instrument (Darmstadt, Germany). Primers used for this study were listed in Table 3. The 2-ΔCt method was used to calculate the relative expression of the target genes where ΔCtmiRNA = CtmiRNA − Cthousekeeping.
Table 3
Primer sequences used in this study
miRNAs
Primer Sequences 5′-3′
hsa-miR-3113-5p
GTCCTGGCCCTGGTCCGGGTCC
hsa-miR-499a-5p
TTAAGACTTGCAGTGATGTTT
hsa-miR-223-3p
TGTCAGTTTGTCAAATACCCCA
hsa-miR-133a-3p
TTTGGTCCCCTTCAACCAGCTG

Statistical analysis

All data were expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed using independent Student’s t test. The diagnostic powers of miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p were evaluated by receiver operating characteristic (ROC) analysis. Areas under the curve (AUCs) were calculated. All statistical analyses were performed using GraphPad Prism 8.0 software (La Giolla, CA, USA). P < 0.05 was considered as statistically significant.

Results

Cases from the SCD-negative autopsy group did not show notable pathological changes

As shown in Table 1, the four categories of cases showed similar survival intervals (within 2 h). The cases from the SCD-positive autopsy group had significant increases in the heart weight as compared with both control cases (p < 0.001). The heart weight of the SCD-negative autopsy group was, however, significantly lower than that of the SCD-positive autopsy group (p < 0.05), though it was still higher than both control cases (Table 1). Furthermore, SCD-negative autopsy cases were not identified of any gross cardiovascular change as similar with control cases, while 56.2% (n = 9) of SCD-positive autopsy cases showed coronary stenosis (50–75% stenosis), calcification and myocardial fibrosis, and the remaining 43.8% (n = 7) showed coronary stenosis (> 75%), severe myocardial fibrosis and disorder (Table 2 and Fig. 1). The myocardium from the SCD-positive autopsy group was disarrayed with a halo of fibrotic tissues within the degenerated myocardium (Fig. 1). In consistent with the short survival time, 88.9% of SCD-negative autopsy cases showed histological evidence of acute myocardial ischemia (within 2 h) such as interstitial edema, wavy fibers, and hypereosinophilia of cardiomyocytes (Table 2). No evident fibrotic tissue was observed for the SCD-negative autopsy group (Fig. 1).

Common molecular markers failed to discriminate the SCD cases categorized as SCD-negative autopsy from control cases

To further examine molecular alterations in the heart samples of SCD, we assayed the common molecular biomarkers of myocardial injury, including cleaved-Caspase3 (cl-Casp3), CD31, and CD68. Cl-Casp3 is a marker of early myocardial injury and cell apoptosis. CD68 is a marker of macrophage infiltration which often occur one or two days after injury. CD31 is involved in angiogenesis, leukocyte transmigration and integrin activation, and the changes of CD31-positive cells are commonly observed during cardiac remodeling [29]. As expected, the heart samples from the SCD-positive autopsy group showed notable positivity of cl-Casp3 and CD68. Neovascularization was also evident in the SCD-positive autopsy group as by IHC staining of CD31. The SCD-negative autopsy group showed patchy positivity of cl-Casp3 and dim CD31 signal, and was absent of CD68 positivity. These changes were milder as compared with the SCD-positive autopsy group, though they were to some extent pathological as compared with the fatal injury and CO intoxication cases that were consistently absent of cl-Casp3, CD31, and CD68 positivity (Fig. 2). These data suggested that SCD-negative autopsy was hard to be discriminated using the histological and IHC assays.

miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p significantly upregulated in the SCD

In view that common histological and IHC techniques could not aid in diagnosing SCD-negative autopsy, we speculated that small-molecules might be helpful. We thus assessed whether four cardio-miRNAs (miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p) had any diagnostic values. The selection of these miRNAs was based on published literature [28, 30, 31] and our previous work [26] . Our aims were two-fold: one to assess whether these miRNAs could diagnose SCD, and the other one to assess whether specific miRNAs had higher efficacy as to discriminate the causes of SCD. To this end, we initially pooled the SCD-positive autopsy and SCD-negative autopsy groups as SCD cases. RT-qPCR was performed with U6 as a stable reference gene. Our results revealed that miR-3113-5p was significantly elevated by approximate five-fold in the SCD groups (Fig. 3A). miR-223-3p and miR-499a-5p were also increased by approximate five-fold (Fig. 3B and C). miR-133a-3p showed significant increases for approximate three-fold when compared to both controls (Fig. 3D).

miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p could aid in diagnosing SCD

We next assessed the diagnostic values of these miRNAs for distinguishing SCD from non-cardiac deaths. Receiver operating characteristic (ROC) curve analysis showed that the area under the curve (AUC) of miR-3113-5p were 0.7893 (SCD vs Fatal injury: 95% confidence interval (CI) = 0.6501 to 0.9176, sensitivity = 68.75% and specificity = 83.33%) and 0.8281 (SCD vs CO intoxication: 95% CI = 0.7071 to 0.9492, sensitivity = 68.75% and specificity = 91.67%) (Fig. 4A and B). The AUCs of miR-223-3p were 0.9043 (SCD vs Fatal injury: 95% CI = 0.8031 to 1.006, sensitivity = 83.33% and specificity = 88.89%) and 0.8917 (SCD vs CO intoxication: 95% CI = 0.7984 to 0.9849, sensitivity =75% and specificity = 100%) (Fig. 4C and D). The AUCs of miR-499a-5p were 0.8971 (SCD vs Fatal injury: 95% CI = 0.7972 to 0.9969, sensitivity = 82.35% and specificity = 90%) and 0.8853 (SCD vs CO intoxication: 95% CI = 0.7771 to 0.9935, sensitivity =97.06% and specificity = 70%) (Fig. 4E and F). The AUCs of miR-133a-3p were 0.7851 (SCD vs Fatal injury: 95% CI = 0.6466 to 0.9235, sensitivity = 67.65% and specificity =76.92%) and 0.8743 (SCD vs CO intoxication: 95% CI = 0.7693 to 0.9793, sensitivity =64.71% and specificity = 100%), respectively (Fig. 4G and H). Detailed ROC analysis results were listed in Table 4. These results demonstrated that miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p could be used as sensitive biomarkers for diagnosis of SCD.
Table 4
Receive operating characteristic (ROC) analysis of miRNAs
 
AUC
Std.Error
P value
LB(95%)
UB(95%)
Sensitivity
Specificity
Youden index
miR-3113-5p SCD vs Fatal injury
0.7839
0.06823
0.004091
0.6501
0.9176
68.75%
83.33%
0.52
miR-3113-5p SCD vs CO intoxication
0.8281
0.06175
0.0009054
0.7071
0.9492
68.75%
91.67%
0.60
miR-223-3p SCD vs Fatal injury
0.9043
0.05161
0.0002037
0.8031
1.006
83.33%
88.89%
0.72
miR-223-3p SCD vs CO intoxication
0.8917
0.04755
0.0001753
0.7984
0.9849
75%
100%
0.75
miR-499a-5p SCD vs Fatal injury
0.8971
0.05094
0.0001582
0.7972
0.9969
82.35%
90%
0.72
miR-499a-5p SCD vs CO intoxication
0.8853
0.05518
0.0002463
0.7771
0.9935
97.06%
70%
0.67
miR-133a-3p SCD vs Fatal injury
0.7851
0.07063
0.002743
0.6466
0.9235
67.65%
76.92%
0.45
miR-133a-3p SCD vs CO intoxication
0.8743
0.05356
0.0002201
0.7693
0.9793
64.71%
100%
0.65
AUC Area under the curve, LB Lower bound, UB Upper bound

miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p were significantly up-regulated in the SCD-negative autopsy group compared with the SCD-positive autopsy group

To precisely evaluate the power of the four miRNAs in predicting SCD, SCD was divided into SCD-positive autopsy (with gross coronary artery stenosis) and SCD-negative autopsy (without gross heart changes). Meanwhile, the expression patterns of the four miRNAs were detected in SCD-positive autopsy and SCD-negative autopsy groups by RT-qPCR. Interestingly, miR-3113-5p (Fig. 5A), miR-223-3p (Fig. 5B), miR-499a-5p (Fig. 5C), and miR-133a-3p (Fig. 5D) were all significantly higher in the SCD-negative autopsy group than those in the SCD-positive autopsy group with the fold-change ranging from two to three (p < 0.05).

Diagnostic efficiency of the miRNAs in discriminating the detailed causes of SCD

Next, ROC curve analyses were used to assess the diagnostic ability of the four miRNAs for discriminating SCD-negative autopsy from SCD-positive autopsy. It revealed that neither of these miRNAs alone efficiently discriminated SCD-negative autopsy (AUC was 0.7373 for miR-3113-5p, AUC was 0.7200 for miR-223-3p, AUC was 0.7569 for miR-133a-3p, and AUC was 0.7951 for miR-499a-5p), indicating that SCD-negative autopsy and SCD-positive autopsy both shared common pathologic basis, albeit SCD-negative autopsy occurring in a sudden and unidentified way. We then assessed the ROC by combing these miRNAs. Our results showed that the AUC of a combination of miR-3113-5p and miR-223-3p was 0.8667 (95% CI = 0.7388 to 0.9945, sensitivity = 82.35% and specificity =80%, Fig. 6A). The AUC of a combination of miR-3113-5p and miR-499a-5p was 0.8510 (95% CI = 0.7105 to 0.9915, sensitivity = 100% and specificity =66.67%, Fig. 6B). The AUC of a combination of miR-3113-5p and miR-133a-3p was 0.7686 (95% CI = 0.6032 to 0.9341, sensitivity =70.59% and specificity =80%, Fig. 6C). The AUC of a combination of miR-499a-5p and miR-133a-3p was 0.7569 (95% CI = 0.5938 to 0.9201, sensitivity = 66.67% and specificity =81.25%, Fig. 6D). The AUC of a combination of miR-223-3p and miR-499a-5p was 0.7741 (95% CI = 0.6062 to 0.9419, sensitivity = 88.89% and specificity =60%, Fig. 6E). The AUC of a combination of miR-223-3p and miR-133a-3p was 0.7407 (95% CI = 0.5700 to 0.9115, sensitivity = 66.67% and specificity =80%, Fig. 6F). The details were shown in Table 5. These results demonstrated that miR-3113-5p and miR-223-3p together yielded the highest diagnostic performance in discriminating SCD-negative autopsy from SCD-positive autopsy (maximum of AUC). miR-3113-5p and miR-499a-5p together also showed high AUC values and sensitivity (maximum of Youden’s index).
Table 5
Receive operating characteristic (ROC) analysis of miRNAs
 
AUC
Std.Error
P value
LB(95%)
UB(95%)
Sensitivity
Specificity
Youden index
miR-3113-5p & miR-223-3p
0.8667
0.06520
0.0004180
0.7388
0.9945
82.35%
80%
0.62
miR-3113-5p & miR-499a-5p
0.8510
0.07165
0.0007310
0.7105
0.9915
100%
66.67%
0.67
miR-3113-5p & miR-133a-3p
0.7686
0.08438
0.009717
0.6032
0.9341
70.59%
80%
0.51
miR-499a-5p & miR-133a-3p
0.7569
0.08320
0.01070
0.5938
0.9201
66.67%
81.25%
0.48
miR-223-3p & miR-499a-5p
0.7741
0.08562
0.007487
0.6062
0.9419
88.89%
60%
0.49
miR-223-3p & miR-133a-3p
0.7407
0.08709
0.01881
0.5700
0.9115
66.67%
80%
0.47
AUC Area under the curve, LB Lower bound, UB Upper bound

Discussion

Cardiovascular disease is still the main cause of morbidity and mortality worldwide. miRNAs play important roles in regulating cardiac development, remodeling and regeneration, endothelial function, vasculogenesis and neoangiogenesis through a variety of pathways [32]. Aberrant miRNA expression profiles are associated with various cardiovascular conditions such as hypertrophy, fibrosis, heart failure, and arrhythmias [33]. Studies have shown that miRNAs are circulating freely in mammalian blood with marked biostability and can be detected with high sensitivity and specificity in human plasma and serum [34]. So, the diagnostic potential of miRNA detection in human plasma for cardiovascular disorders was to be explored. Coronary artery disease is the main cause of SCD. It was reported that the circulating miR-1 [35] and miR-208a [36] significantly increased in AMI patients compared to non-AMI controls, indicating miR-1 and miR-208a in serum may serve as biomarkers for AMI. miR-1 is also upregulated in the heart from patients with coronary artery disease and in rat ischemic hearts, which correlates to an increase in arrhythmogenesis [37]. miR-135a increased and miR-147 decreased significantly in plasma of atherosclerotic cardiovascular diseases patients, and miR-135a/miR-147 ratio could be used for atherosclerotic cardiovascular diseases diagnosis [38]. Circulating miR-106a may function as potential biomarker in patients with coronary artery disease [39]. Although there has been many researches focusing on circulating/plasma biomarkers to enhance SCD risk prediction and diagnostic performance, few cardio-miRNAs have previously been identified, and none of these biomarkers have progressed to clinical use for SCD. Thus, there remains a critical need to identify biomarkers of SCD.
Several studies have reported that miR-223 is associated with myocardial diseases. miR-223-3p inhibits ischemia-reperfusion induced cardiac necroptosis at multiple layers which may constitute a new therapeutic agent for the treatment of ischemic heart disease [30]. miR-223 was also shown to be downregulated in ET-1 induced hypertrophic myocardium by targeting TNNI3K [40]. miR-223 was upregulated in a rat model of AMI and its overexpression promoted cardiac arrhythmias [23]; thus, miR-223 may be a new target in the treatment of ischemic arrhythmias. Our previous research showed that cardiac miR-3113-5p might be a useful target for therapeutic purposes and circulating miR-3113-5p might serve as a stable marker for early diagnosis of cardiac ischemia-reperfusion injury [26]. miR-499-5p is highly conserved and preferentially expressed in the myocardium [41]; circulating levels of miR-499-5p were significantly higher at admission in AMI patients that died within the following year as compared to those who survived the cardiovascular event [42]. Overexpression of miR-499-5p in cardiomyocytes was able to protect the heart against myocardial infarction-associated tissue damage in vivo [43]. A study reported that miR-133a-3p inhibits cardiomyocyte apoptosis by targeting caspase-9 [44], and miR-133a-3p has been implicated in the control of myocardial fibrosis [45]. The above reports suggested these microRNAs had clinical importance in the diagnosis of SCD.
Many studies have recommended histological and IHC markers to be applied in the diagnosis of myocardial damage [4648]. Pertaining to the early myocardial damage, IHC staining has particular advantages due to their useful application in FFPE tissues and in assessing ischemic areas during acute myocardial ischemia [46]. Unfortunately, a single immunohistochemical marker often cannot meet the requirements of diagnosis when no macroscopic or microscopic evidence of necrosis is available, and the IHC staining may be inevitably affected by sampling bias and interpretation controversy [4648]. In this study, immunohistochemical markers (cell apoptotic marker cl-Casp3, angiogenesis marker CD31, and macrophage infiltration marker CD68) were found to not aid in diagnosing SCD-negative autopsy. Small-molecules, namely the four cardio-miRNAs (miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p) were, however, found to be useful to diagnose SCD in human real cases. Our study demonstrated that miR-3113-5p, miR-223-3p, miR-499a-5p and miR-133a-3p may serve as candidate diagnostic biomarkers for SCD, allowing to distinguish subjects with SCD from others. The expression levels of miR-3113-5p, miR-223-3p, miR-499a-5p and miR-133a-3p were significantly up-regulated in the heart tissues from SCD as compared to control subjects. The ROC analysis revealed that the four miRNAs may serve as independent diagnostic markers of SCD. Among the miRNAs, miR-223-3p and miR-499a-5p showed better accuracy with the highest AUC values. In particular, we further found that several miRNA panels consisting two of the four miRNAs could achieve better discriminative capacity when discriminating the causes of SCD. These results showed that miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p may be considered as potential candidate biomarkers for diagnosis of SCD.
Previous studies have focused on circulating miRNAs that may be novel biomarkers for SCD-negative autopsy or SCD. For example, an elevated level of circulating miR-133a may serve as a diagnostic marker of AMI [49]. Circulating miR-499 and miR-223 can effectively differentiate AMI from non-AMI patients [50]. Unfortunately, these studies mainly focused on plasma or serum samples. The role of these miRNAs at their origin (cardiac-derived miRNAs, cardio-miRNAs) remained largely unknown. To this end, we used human heart samples to evaluate these cardio-miRNAs in SCD cases. Archival FFPE heart tissue samples are readily available resources for miRNA biomarker identification [51]. It has been demonstrated that miR-1, miR-499, miR-133, and miR-208 are sensitive markers to diagnose SCD-negative autopsy and SCD using post-mortem FFPE heart tissues [28], an observation that was also confirmed by the current study. In addition, our study represents the first one, to the best knowledge of us, to report the expression profiling of miR-3113-5p and miR-223-3p in FFPE heart tissues, and extended their biological importance as a diagnostic biomarker for SCD.
For a long time, the study of miRNAs could only be performed in model animals which was defected from clinical and forensic reality. The present study used FFPE tissues as a novel research material to maximally promote the findings conforming with human bodies. FFPE samples are valuable research materials, stored in pathology archives worldwide. Storing FFPE specimens is more economical than storing frozen samples, and the histological structure can be preserved almost permanently [51]. However, formalin fixation and paraffin embedding inevitably lead to nucleic acids degradation in these tissues. DNA and RNA are fragmented and chemically modified [52], which sometimes causes inconsistency between the results obtained using matched fresh and FFPE samples [53]. Fortunately, miRNAs are robust and stable in FFPE heart tissues, which can be utilized as deep sequencing and quantitative qPCR analyses [54]. A study has suggested that miRNAs remain highly stable in postmortem FFPE heart tissues, and validated that miR-1, miR-208b, and miR-499a in FFPE heart tissues are diagnostic biomarkers for SCD-negative autopsy patients [28]. Therefore, we believe that the use of FFPE as a clinic relevant material opens novel insights into disease pathogenesis, particularly with regard to the identification of miRNAs.

Conclusions

Our study showed the potential of miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p as candidate biomarkers for diagnosis of SCD. We propose that individual of miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p can serve as sensitive biomarkers to diagnose SCD, and a pool of these miRNAs could be further used to discriminate the causes of SCD, particularly the cases without positive autopsy findings.

Declarations

This study was approved by the Institutional Review Board at the Gannan Medical University (approval number 2019161). Additional informed consent was not required by the Institutional Review Board (IRB) since this study only re-used the FFPE blocks that have already been archived after forensic medical examination.
Not applicable.

Competing interests

The authors declare that they have no competing interests.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://​creativecommons.​org/​licenses/​by/​4.​0/​. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Literatur
2.
Zurück zum Zitat Priori SG, Blomstrom-Lundqvist C, Mazzanti A, Blom N, Borggrefe M, Camm J, et al. 2015 ESC Guidelines for the management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: The Task Force for the Management of Patients with Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death of the European Society of Cardiology (ESC). Endorsed by: Association for European Paediatric and Congenital Cardiology (AEPC). Eur Heart J. 2015;36(41):2793–867.CrossRefPubMed Priori SG, Blomstrom-Lundqvist C, Mazzanti A, Blom N, Borggrefe M, Camm J, et al. 2015 ESC Guidelines for the management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: The Task Force for the Management of Patients with Ventricular Arrhythmias and the Prevention of Sudden Cardiac Death of the European Society of Cardiology (ESC). Endorsed by: Association for European Paediatric and Congenital Cardiology (AEPC). Eur Heart J. 2015;36(41):2793–867.CrossRefPubMed
3.
Zurück zum Zitat Shan H, Li X, Pan Z, Zhang L, Cai B, Zhang Y, et al. And others. Tanshinone IIA protects against sudden cardiac death induced by lethal arrhythmias via repression of microRNA-1. Br J Pharmacol. 2009;158(5):1227–35.PubMedPubMedCentralCrossRef Shan H, Li X, Pan Z, Zhang L, Cai B, Zhang Y, et al. And others. Tanshinone IIA protects against sudden cardiac death induced by lethal arrhythmias via repression of microRNA-1. Br J Pharmacol. 2009;158(5):1227–35.PubMedPubMedCentralCrossRef
4.
Zurück zum Zitat Chatterjee NA, Levy WC. Sudden cardiac death after myocardial infarction. Eur J Heart Fail. 2020;22(5):856–8.PubMedCrossRef Chatterjee NA, Levy WC. Sudden cardiac death after myocardial infarction. Eur J Heart Fail. 2020;22(5):856–8.PubMedCrossRef
5.
Zurück zum Zitat Thygesen K, Alpert JS, Jaffe AS, Simoons ML, Chaitman BR, White HD, et al. And others. Third universal definition of myocardial infarction. Eur Heart J. 2012;33(20):2551–67.PubMedCrossRef Thygesen K, Alpert JS, Jaffe AS, Simoons ML, Chaitman BR, White HD, et al. And others. Third universal definition of myocardial infarction. Eur Heart J. 2012;33(20):2551–67.PubMedCrossRef
6.
Zurück zum Zitat Borne RT, Katz D, Betz J, Peterson PN, Masoudi FA. Implantable cardioverter-defibrillators for secondary prevention of sudden cardiac death: a review. J Am Heart Assoc. 2017;6(3):e005515. Borne RT, Katz D, Betz J, Peterson PN, Masoudi FA. Implantable cardioverter-defibrillators for secondary prevention of sudden cardiac death: a review. J Am Heart Assoc. 2017;6(3):e005515.
7.
Zurück zum Zitat Myerburg RJ, Goldberger JJ. Sudden cardiac arrest risk assessment: population science and the individual risk mandate. JAMA Cardiol. 2017;2(6):689–94.PubMedCrossRef Myerburg RJ, Goldberger JJ. Sudden cardiac arrest risk assessment: population science and the individual risk mandate. JAMA Cardiol. 2017;2(6):689–94.PubMedCrossRef
8.
Zurück zum Zitat El-Battrawy I, Borggrefe M, Akin I. The risk for sudden cardiac death and effect of treatment with Sacubitril/valsartan in heart failure. JACC Heart Fail. 2019;7(11):999.PubMedCrossRef El-Battrawy I, Borggrefe M, Akin I. The risk for sudden cardiac death and effect of treatment with Sacubitril/valsartan in heart failure. JACC Heart Fail. 2019;7(11):999.PubMedCrossRef
9.
Zurück zum Zitat Corrado D, Zorzi A, Vanoli E, Gronda E. Current challenges in sudden cardiac death prevention. Heart Fail Rev. 2020;25(1):99–106.PubMedCrossRef Corrado D, Zorzi A, Vanoli E, Gronda E. Current challenges in sudden cardiac death prevention. Heart Fail Rev. 2020;25(1):99–106.PubMedCrossRef
10.
Zurück zum Zitat Basso C, Carturan E, Pilichou K, Rizzo S, Corrado D, Thiene G. Sudden cardiac death with normal heart: molecular autopsy. Cardiovasc Pathol. 2010;19(6):321–5.PubMedCrossRef Basso C, Carturan E, Pilichou K, Rizzo S, Corrado D, Thiene G. Sudden cardiac death with normal heart: molecular autopsy. Cardiovasc Pathol. 2010;19(6):321–5.PubMedCrossRef
11.
Zurück zum Zitat Calore C, De Bortoli M, Romualdi C, Lorenzon A, Angelini A, Basso C, et al. A founder MYBPC3 mutation results in HCM with a high risk of sudden death after the fourth decade of life. J Med Genet. 2015;52(5):338–47.PubMedCrossRef Calore C, De Bortoli M, Romualdi C, Lorenzon A, Angelini A, Basso C, et al. A founder MYBPC3 mutation results in HCM with a high risk of sudden death after the fourth decade of life. J Med Genet. 2015;52(5):338–47.PubMedCrossRef
12.
Zurück zum Zitat Chen YH, Liu JM, Hsu RJ, Hu SC, Harn HJ, Chen SP, et al. Angiotensin converting enzyme DD genotype is associated with acute coronary syndrome severity and sudden cardiac death in Taiwan: a case-control emergency room study. BMC Cardiovasc Disord. 2012;12:6.PubMedPubMedCentralCrossRef Chen YH, Liu JM, Hsu RJ, Hu SC, Harn HJ, Chen SP, et al. Angiotensin converting enzyme DD genotype is associated with acute coronary syndrome severity and sudden cardiac death in Taiwan: a case-control emergency room study. BMC Cardiovasc Disord. 2012;12:6.PubMedPubMedCentralCrossRef
13.
Zurück zum Zitat Lahtinen AM, Havulinna AS, Noseworthy PA, Jula A, Karhunen PJ, Perola M, et al. Prevalence of arrhythmia-associated gene mutations and risk of sudden cardiac death in the Finnish population. Ann Med. 2013;45(4):328–35.PubMedCrossRef Lahtinen AM, Havulinna AS, Noseworthy PA, Jula A, Karhunen PJ, Perola M, et al. Prevalence of arrhythmia-associated gene mutations and risk of sudden cardiac death in the Finnish population. Ann Med. 2013;45(4):328–35.PubMedCrossRef
14.
Zurück zum Zitat Pokharel Y, Sharma PP, Qintar M, Lu Y, Tang Y, Jones P, et al. High-sensitivity C-reactive protein levels and health status outcomes after myocardial infarction. Atherosclerosis. 2017;266:16–23.PubMedPubMedCentralCrossRef Pokharel Y, Sharma PP, Qintar M, Lu Y, Tang Y, Jones P, et al. High-sensitivity C-reactive protein levels and health status outcomes after myocardial infarction. Atherosclerosis. 2017;266:16–23.PubMedPubMedCentralCrossRef
15.
Zurück zum Zitat Viereck J, Thum T. Circulating noncoding RNAs as biomarkers of cardiovascular disease and injury. Circ Res. 2017;120(2):381–99.PubMedCrossRef Viereck J, Thum T. Circulating noncoding RNAs as biomarkers of cardiovascular disease and injury. Circ Res. 2017;120(2):381–99.PubMedCrossRef
16.
Zurück zum Zitat Bjorkman S, Taylor HS. MicroRNAs in endometriosis: biological function and emerging biomarker candidatesdagger. Biol Reprod. 2019;100(5):1135–46.PubMedPubMedCentral Bjorkman S, Taylor HS. MicroRNAs in endometriosis: biological function and emerging biomarker candidatesdagger. Biol Reprod. 2019;100(5):1135–46.PubMedPubMedCentral
17.
Zurück zum Zitat Colpaert R, Calore M. MicroRNAs in cardiac diseases, Cells. 2019;8(7):737. Colpaert R, Calore M. MicroRNAs in cardiac diseases, Cells. 2019;8(7):737.
18.
Zurück zum Zitat Cheng M, Yang J, Zhao X, Zhang E, Zeng Q, Yu Y, et al. Circulating myocardial microRNAs from infarcted hearts are carried in exosomes and mobilise bone marrow progenitor cells. Nat Commun. 2019;10(1):959.PubMedPubMedCentralCrossRef Cheng M, Yang J, Zhao X, Zhang E, Zeng Q, Yu Y, et al. Circulating myocardial microRNAs from infarcted hearts are carried in exosomes and mobilise bone marrow progenitor cells. Nat Commun. 2019;10(1):959.PubMedPubMedCentralCrossRef
19.
Zurück zum Zitat Elia L, Condorelli G. MicroRNAs and pulmonary hypertension: a tight link. Cardiovasc Res. 2016;111(3):163–4.PubMedCrossRef Elia L, Condorelli G. MicroRNAs and pulmonary hypertension: a tight link. Cardiovasc Res. 2016;111(3):163–4.PubMedCrossRef
20.
Zurück zum Zitat Oner T, Arslan C, Yenmis G, Arapi B, Tel C, Aydemir B, et al. Association of NFKB1A and microRNAs variations and the susceptibility to atherosclerosis. J Genet. 2017;96(2):251–9.PubMedCrossRef Oner T, Arslan C, Yenmis G, Arapi B, Tel C, Aydemir B, et al. Association of NFKB1A and microRNAs variations and the susceptibility to atherosclerosis. J Genet. 2017;96(2):251–9.PubMedCrossRef
21.
Zurück zum Zitat Mansueto G, Benincasa G, Della MN, Nicoletti GF, Napoli C. Epigenetic-sensitive liquid biomarkers and personalised therapy in advanced heart failure: a focus on cell-free DNA and microRNAs. J Clin Pathol. 2020;73(9):535–43.PubMedCrossRef Mansueto G, Benincasa G, Della MN, Nicoletti GF, Napoli C. Epigenetic-sensitive liquid biomarkers and personalised therapy in advanced heart failure: a focus on cell-free DNA and microRNAs. J Clin Pathol. 2020;73(9):535–43.PubMedCrossRef
22.
Zurück zum Zitat Komal S, Yin JJ, Wang SH, Huang CZ, Tao HL, Dong JZ, et al. MicroRNAs: emerging biomarkers for atrial fibrillation. J Cardiol. 2019;74(6):475–82.PubMedCrossRef Komal S, Yin JJ, Wang SH, Huang CZ, Tao HL, Dong JZ, et al. MicroRNAs: emerging biomarkers for atrial fibrillation. J Cardiol. 2019;74(6):475–82.PubMedCrossRef
23.
Zurück zum Zitat Liu X, Zhang Y, Du W, Liang H, He H, Zhang L, et al. And others. MiR-223-3p as a novel MicroRNA regulator of expression of voltage-gated K+ channel Kv4.2 in acute myocardial infarction. Cell Physiol Biochem. 2016;39(1):102–14.PubMedCrossRef Liu X, Zhang Y, Du W, Liang H, He H, Zhang L, et al. And others. MiR-223-3p as a novel MicroRNA regulator of expression of voltage-gated K+ channel Kv4.2 in acute myocardial infarction. Cell Physiol Biochem. 2016;39(1):102–14.PubMedCrossRef
24.
Zurück zum Zitat Peng XP, Huang L, Liu ZH. miRNA-133a attenuates lipid accumulation via TR4-CD36 pathway in macrophages. Biochimie. 2016;127:79–85.PubMedCrossRef Peng XP, Huang L, Liu ZH. miRNA-133a attenuates lipid accumulation via TR4-CD36 pathway in macrophages. Biochimie. 2016;127:79–85.PubMedCrossRef
25.
Zurück zum Zitat Chen X, Zhang L, Su T, Li H, Huang Q, Wu D, et al. Kinetics of plasma microRNA-499 expression in acute myocardial infarction. J Thorac Dis. 2015;7(5):890–6.PubMedPubMedCentral Chen X, Zhang L, Su T, Li H, Huang Q, Wu D, et al. Kinetics of plasma microRNA-499 expression in acute myocardial infarction. J Thorac Dis. 2015;7(5):890–6.PubMedPubMedCentral
27.
Zurück zum Zitat Courts C, Madea B. Micro-RNA - a potential for forensic science? Forensic Sci Int. 2010;203(1–3):106–11.PubMedCrossRef Courts C, Madea B. Micro-RNA - a potential for forensic science? Forensic Sci Int. 2010;203(1–3):106–11.PubMedCrossRef
28.
Zurück zum Zitat Pinchi E, Frati P, Aromatario M, Cipolloni L, Fabbri M, La Russa R, et al. And others. miR-1, miR-499 and miR-208 are sensitive markers to diagnose sudden death due to early acute myocardial infarction. J Cell Mol Med. 2019;23(9):6005–16.PubMedPubMedCentralCrossRef Pinchi E, Frati P, Aromatario M, Cipolloni L, Fabbri M, La Russa R, et al. And others. miR-1, miR-499 and miR-208 are sensitive markers to diagnose sudden death due to early acute myocardial infarction. J Cell Mol Med. 2019;23(9):6005–16.PubMedPubMedCentralCrossRef
29.
Zurück zum Zitat Singla D, Wang J. Fibroblast growth Factor-9 activates c-kit progenitor cells and enhances angiogenesis in the infarcted diabetic heart. Oxidative Med Cell Longev. 2016;2016:5810908.CrossRef Singla D, Wang J. Fibroblast growth Factor-9 activates c-kit progenitor cells and enhances angiogenesis in the infarcted diabetic heart. Oxidative Med Cell Longev. 2016;2016:5810908.CrossRef
30.
Zurück zum Zitat Qin D, Wang X, Li Y, Yang L, Wang R, Peng J, et al. And others. MicroRNA-223-5p and -3p cooperatively suppress Necroptosis in ischemic/Reperfused hearts. J Biol Chem. 2016;291(38):20247–59.PubMedPubMedCentralCrossRef Qin D, Wang X, Li Y, Yang L, Wang R, Peng J, et al. And others. MicroRNA-223-5p and -3p cooperatively suppress Necroptosis in ischemic/Reperfused hearts. J Biol Chem. 2016;291(38):20247–59.PubMedPubMedCentralCrossRef
31.
Zurück zum Zitat Ren L, Wang Q, Chen Y, Ma Y, Wang D. Involvement of MicroRNA-133a in the protective effect of hydrogen sulfide against ischemia/reperfusion-induced endoplasmic reticulum stress and Cardiomyocyte apoptosis. Pharmacology. 2019;103(1–2):1–9.PubMedCrossRef Ren L, Wang Q, Chen Y, Ma Y, Wang D. Involvement of MicroRNA-133a in the protective effect of hydrogen sulfide against ischemia/reperfusion-induced endoplasmic reticulum stress and Cardiomyocyte apoptosis. Pharmacology. 2019;103(1–2):1–9.PubMedCrossRef
32.
Zurück zum Zitat Song Z, Gao R, Yan B. Potential roles of microRNA-1 and microRNA-133 in cardiovascular disease. Rev Cardiovasc Med. 2020;21(1):57–64.PubMedCrossRef Song Z, Gao R, Yan B. Potential roles of microRNA-1 and microRNA-133 in cardiovascular disease. Rev Cardiovasc Med. 2020;21(1):57–64.PubMedCrossRef
33.
Zurück zum Zitat Zhou SS, Jin JP, Wang JQ, Zhang ZG, Freedman JH, Zheng Y, et al. miRNAS in cardiovascular diseases: potential biomarkers, therapeutic targets and challenges. Acta Pharmacol Sin. 2018;39(7):1073–84.PubMedPubMedCentralCrossRef Zhou SS, Jin JP, Wang JQ, Zhang ZG, Freedman JH, Zheng Y, et al. miRNAS in cardiovascular diseases: potential biomarkers, therapeutic targets and challenges. Acta Pharmacol Sin. 2018;39(7):1073–84.PubMedPubMedCentralCrossRef
34.
Zurück zum Zitat Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, Pogosova-Agadjanyan EL, et al. And others. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A. 2008;105(30):10513–8.PubMedPubMedCentralCrossRef Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, Pogosova-Agadjanyan EL, et al. And others. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A. 2008;105(30):10513–8.PubMedPubMedCentralCrossRef
35.
Zurück zum Zitat Sun T, Zhang L, Li X, Chen F, Li Y, Ma X, et al. MicroRNA-1 and circulating microvesicles mediate the protective effects of Dantonic in acute myocardial infarction rat models. Front Physiol. 2018;9:664.PubMedPubMedCentralCrossRef Sun T, Zhang L, Li X, Chen F, Li Y, Ma X, et al. MicroRNA-1 and circulating microvesicles mediate the protective effects of Dantonic in acute myocardial infarction rat models. Front Physiol. 2018;9:664.PubMedPubMedCentralCrossRef
36.
Zurück zum Zitat Wang GK, Zhu JQ, Zhang JT, Li Q, Li Y, He J, et al. Circulating microRNA: a novel potential biomarker for early diagnosis of acute myocardial infarction in humans. Eur Heart J. 2010;31(6):659–66.PubMedCrossRef Wang GK, Zhu JQ, Zhang JT, Li Q, Li Y, He J, et al. Circulating microRNA: a novel potential biomarker for early diagnosis of acute myocardial infarction in humans. Eur Heart J. 2010;31(6):659–66.PubMedCrossRef
37.
Zurück zum Zitat Yang B, Lin H, Xiao J, Lu Y, Luo X, Li B, et al. And others. The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. Nat Med. 2007;13(4):486–91.PubMedCrossRef Yang B, Lin H, Xiao J, Lu Y, Luo X, Li B, et al. And others. The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. Nat Med. 2007;13(4):486–91.PubMedCrossRef
38.
Zurück zum Zitat Hoekstra M, van der Lans CA, Halvorsen B, Gullestad L, Kuiper J, Aukrust P, et al. The peripheral blood mononuclear cell microRNA signature of coronary artery disease. Biochem Biophys Res Commun. 2010;394(3):792–7.PubMedCrossRef Hoekstra M, van der Lans CA, Halvorsen B, Gullestad L, Kuiper J, Aukrust P, et al. The peripheral blood mononuclear cell microRNA signature of coronary artery disease. Biochem Biophys Res Commun. 2010;394(3):792–7.PubMedCrossRef
39.
Zurück zum Zitat Ding H, Hu CX, Xu JK. Circulating miR-106a may function as potential biomarkers in patients with coronary artery disease. Clin Lab. 2019;65(10). Ding H, Hu CX, Xu JK. Circulating miR-106a may function as potential biomarkers in patients with coronary artery disease. Clin Lab. 2019;65(10).
40.
Zurück zum Zitat Wang YS, Zhou J, Hong K, Cheng XS, Li YG. MicroRNA-223 displays a protective role against cardiomyocyte hypertrophy by targeting cardiac troponin I-interacting kinase. Cell Physiol Biochem. 2015;35(4):1546–56.PubMedCrossRef Wang YS, Zhou J, Hong K, Cheng XS, Li YG. MicroRNA-223 displays a protective role against cardiomyocyte hypertrophy by targeting cardiac troponin I-interacting kinase. Cell Physiol Biochem. 2015;35(4):1546–56.PubMedCrossRef
41.
Zurück zum Zitat Raponi M, Dossey L, Jatkoe T, Wu X, Chen G, Fan H, et al. MicroRNA classifiers for predicting prognosis of squamous cell lung cancer. Cancer Res. 2009;69(14):5776–83.PubMedCrossRef Raponi M, Dossey L, Jatkoe T, Wu X, Chen G, Fan H, et al. MicroRNA classifiers for predicting prognosis of squamous cell lung cancer. Cancer Res. 2009;69(14):5776–83.PubMedCrossRef
42.
Zurück zum Zitat Zhao J, Yu H, Yan P, Zhou X, Wang Y, Yao Y. Circulating MicroRNA-499 as a diagnostic biomarker for acute myocardial infarction: a meta-analysis. Dis Markers. 2019;2019:6121696.PubMedPubMedCentralCrossRef Zhao J, Yu H, Yan P, Zhou X, Wang Y, Yao Y. Circulating MicroRNA-499 as a diagnostic biomarker for acute myocardial infarction: a meta-analysis. Dis Markers. 2019;2019:6121696.PubMedPubMedCentralCrossRef
43.
Zurück zum Zitat Shi Y, Han Y, Niu L, Li J, Chen Y. MiR-499 inhibited hypoxia/reoxygenation induced cardiomyocytes injury by targeting SOX6. Biotechnol Lett. 2019;41(6–7):837–47.PubMedPubMedCentralCrossRef Shi Y, Han Y, Niu L, Li J, Chen Y. MiR-499 inhibited hypoxia/reoxygenation induced cardiomyocytes injury by targeting SOX6. Biotechnol Lett. 2019;41(6–7):837–47.PubMedPubMedCentralCrossRef
44.
Zurück zum Zitat He B, Xiao J, Ren AJ, Zhang YF, Zhang H, Chen M, et al. Role of miR-1 and miR-133a in myocardial ischemic postconditioning. J Biomed Sci. 2011;18:22.PubMedPubMedCentralCrossRef He B, Xiao J, Ren AJ, Zhang YF, Zhang H, Chen M, et al. Role of miR-1 and miR-133a in myocardial ischemic postconditioning. J Biomed Sci. 2011;18:22.PubMedPubMedCentralCrossRef
45.
Zurück zum Zitat Yao L, Zhou B, You L, Hu H, Xie R. LncRNA MIAT/miR-133a-3p axis regulates atrial fibrillation and atrial fibrillation-induced myocardial fibrosis. Mol Biol Rep. 2020;47(4):2605–17.PubMedCrossRef Yao L, Zhou B, You L, Hu H, Xie R. LncRNA MIAT/miR-133a-3p axis regulates atrial fibrillation and atrial fibrillation-induced myocardial fibrosis. Mol Biol Rep. 2020;47(4):2605–17.PubMedCrossRef
46.
Zurück zum Zitat Campobasso CP, Dell'Erba AS, Addante A, Zotti F, Marzullo A, Colonna MF. Sudden cardiac death and myocardial ischemia indicators: a comparative study of four immunohistochemical markers. Am J Forensic Med Pathol. 2008;29(2):154–61.PubMedCrossRef Campobasso CP, Dell'Erba AS, Addante A, Zotti F, Marzullo A, Colonna MF. Sudden cardiac death and myocardial ischemia indicators: a comparative study of four immunohistochemical markers. Am J Forensic Med Pathol. 2008;29(2):154–61.PubMedCrossRef
47.
Zurück zum Zitat Ribeiro-Silva A. S MC, Rossi MA. Is immunohistochemistry a useful tool in the postmortem recognition of myocardial hypoxia in human tissue with no morphological evidence of necrosis? Am J Forensic Med Pathol. 2002;23(1):72–7.PubMedCrossRef Ribeiro-Silva A. S MC, Rossi MA. Is immunohistochemistry a useful tool in the postmortem recognition of myocardial hypoxia in human tissue with no morphological evidence of necrosis? Am J Forensic Med Pathol. 2002;23(1):72–7.PubMedCrossRef
48.
Zurück zum Zitat Brinkmann B, Sepulchre MA, Fechner G. The application of selected histochemical and immunohistochemical markers and procedures to the diagnosis of early myocardial damage. Int J Legal Med. 1993;106(3):135–41.PubMedCrossRef Brinkmann B, Sepulchre MA, Fechner G. The application of selected histochemical and immunohistochemical markers and procedures to the diagnosis of early myocardial damage. Int J Legal Med. 1993;106(3):135–41.PubMedCrossRef
49.
Zurück zum Zitat Yuan L, Liu X, Chen F, Zhang L, Chen X, Huang Q, et al. Diagnostic and prognostic value of circulating MicroRNA-133a in patients with acute myocardial infarction. Clin Lab. 2016;62(7):1233–41.PubMed Yuan L, Liu X, Chen F, Zhang L, Chen X, Huang Q, et al. Diagnostic and prognostic value of circulating MicroRNA-133a in patients with acute myocardial infarction. Clin Lab. 2016;62(7):1233–41.PubMed
50.
Zurück zum Zitat Li L, Li S, Wu M, Chi C, Hu D, Cui Y, et al. Early diagnostic value of circulating microRNAs in patients with suspected acute myocardial infarction. J Cell Physiol. 2019;234(8):13649–58.PubMedCrossRef Li L, Li S, Wu M, Chi C, Hu D, Cui Y, et al. Early diagnostic value of circulating microRNAs in patients with suspected acute myocardial infarction. J Cell Physiol. 2019;234(8):13649–58.PubMedCrossRef
51.
Zurück zum Zitat Kakimoto Y, Kamiguchi H, Ochiai E, Satoh F, Osawa M. MicroRNA stability in postmortem FFPE tissues: quantitative analysis using Autoptic samples from acute myocardial infarction patients. PLoS One. 2015;10(6):e0129338.PubMedPubMedCentralCrossRef Kakimoto Y, Kamiguchi H, Ochiai E, Satoh F, Osawa M. MicroRNA stability in postmortem FFPE tissues: quantitative analysis using Autoptic samples from acute myocardial infarction patients. PLoS One. 2015;10(6):e0129338.PubMedPubMedCentralCrossRef
52.
Zurück zum Zitat Kokkat TJ, Patel MS, McGarvey D, LiVolsi VA, Baloch ZW. Archived formalin-fixed paraffin-embedded (FFPE) blocks: a valuable underexploited resource for extraction of DNA, RNA, and protein. Biopreserv Biobank. 2013;11(2):101–6.PubMedPubMedCentralCrossRef Kokkat TJ, Patel MS, McGarvey D, LiVolsi VA, Baloch ZW. Archived formalin-fixed paraffin-embedded (FFPE) blocks: a valuable underexploited resource for extraction of DNA, RNA, and protein. Biopreserv Biobank. 2013;11(2):101–6.PubMedPubMedCentralCrossRef
53.
Zurück zum Zitat Greytak SR, Engel KB, Bass BP, Moore HM. Accuracy of molecular data generated with FFPE biospecimens: lessons from the literature. Cancer Res. 2015;75(8):1541–7.PubMedPubMedCentralCrossRef Greytak SR, Engel KB, Bass BP, Moore HM. Accuracy of molecular data generated with FFPE biospecimens: lessons from the literature. Cancer Res. 2015;75(8):1541–7.PubMedPubMedCentralCrossRef
54.
Zurück zum Zitat Zamarian V, Catozzi C, Ressel L, Finotello R, Ceciliani F, Vilafranca M, et al. MicroRNA expression in formalin-fixed, paraffin-embedded samples of canine cutaneous and Oral melanoma by RT-qPCR. Vet Pathol. 2019;56(6):848–55.PubMedCrossRef Zamarian V, Catozzi C, Ressel L, Finotello R, Ceciliani F, Vilafranca M, et al. MicroRNA expression in formalin-fixed, paraffin-embedded samples of canine cutaneous and Oral melanoma by RT-qPCR. Vet Pathol. 2019;56(6):848–55.PubMedCrossRef
Metadaten
Titel
miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p are sensitive biomarkers to diagnose sudden cardiac death
verfasst von
Fengping Yan
Yuanyuan Chen
Xing Ye
Fu Zhang
Shiquan Wang
Le Zhang
Xiaoting Luo
Publikationsdatum
01.12.2021
Verlag
BioMed Central
Erschienen in
Diagnostic Pathology / Ausgabe 1/2021
Elektronische ISSN: 1746-1596
DOI
https://doi.org/10.1186/s13000-021-01127-x

Weitere Artikel der Ausgabe 1/2021

Diagnostic Pathology 1/2021 Zur Ausgabe

Neu im Fachgebiet Pathologie

Assistierter Suizid durch Infusion von Thiopental

Thiopental Originalie

Als Folge des Urteils des Bundesverfassungsgerichts zur Sterbehilfe im Jahr 2020 wurde in den Jahren 2021–2023 eine Reihe (n = 23) von assistierten Suiziden im Landesinstitut für gerichtliche und soziale Medizin Berlin mit jeweils identischen …

Molekularpathologische Untersuchungen im Wandel der Zeit

Open Access Biomarker Leitthema

Um auch an kleinen Gewebeproben zuverlässige und reproduzierbare Ergebnisse zu gewährleisten ist eine strenge Qualitätskontrolle in jedem Schritt des Arbeitsablaufs erforderlich. Eine nicht ordnungsgemäße Prüfung oder Behandlung des …

Vergleichende Pathologie in der onkologischen Forschung

Pathologie Leitthema

Die vergleichende experimentelle Pathologie („comparative experimental pathology“) ist ein Fachbereich an der Schnittstelle von Human- und Veterinärmedizin. Sie widmet sich der vergleichenden Erforschung von Gemeinsamkeiten und Unterschieden von …

Gastrointestinale Stromatumoren

Open Access GIST CME-Artikel

Gastrointestinale Stromatumoren (GIST) stellen seit über 20 Jahren ein Paradigma für die zielgerichtete Therapie mit Tyrosinkinaseinhibitoren dar. Eine elementare Voraussetzung für eine mögliche neoadjuvante oder adjuvante Behandlung bei …