Background
Heart serves as a biological pump that circulates blood throughout our bodies and thus supplying us with oxygen and nutrients. Irregular cardiac activities can restrict blood supply and lead to sudden cardiac death (SCD) [
1], a condition that is defined as autopsy identification of a cardiac or vascular anomaly as the probable cause of death for seemingly healthy decedents [
2]. SCD is one of the major causes of natural death, causing approximately 1 million of adult deaths in China each year, and remains one of the most challenging tasks in cardiology [
3]. Coronary artery diseases closely associate with the high incidence of SCD cases, particularly myocardial infarction (MI) [
4]. Acute MI (AMI) is defined as myocardial necrosis in a clinical setting consistent with acute myocardial ischemia [
5]. AMI is a specific cause of SCD that often claims deaths in a short period. Unfortunately, deaths from AMI often show negative autopsy findings, and it is not easy to accurately diagnose with the current histopathology techniques. Moreover, data suggested that though implantable cardioverter defibrillators (ICD) have being used to prevent SCD in individuals with existing conditions of cardiomyopathy and inherited arrhythmias [
6], their survival benefits are limited as only 20–30% even under appropriate therapy [
7]. In addition, albeit left ventricular systolic dysfunction and the severity of heart failure symptoms being predictors of SCD [
8], a considerable number of SCD events do not have a pre-existing history of depressed ejection fraction or a clinical history of heart failure [
9]. Furthermore, some SCD cases cannot be explained even after systemic autopsy and histological examination. These cases have been postulated to die largely from AMI without grossly observable pathology [
10]. Therefore, it is an imperative to find sensitive biomarkers that could be used for detection of SCD, particularly SCD with negative autopsy (SCD-negative autopsy) findings.
Currently, mutations of cardiac-related genes have been implicated in the pathogenesis of SCD, such as MYBPC3 [
11], ACE [
12] and PKP2 [
13] . For example, the ACE DD genotype was associated with a 3.35-fold higher risk of AMI, and a significantly higher risk of SCD (odds ratio (OR) = 6.484, 95% confidence interval (CI): 1.036–40.598,
p = 0.046) [
12] . Inflammation is also reported to play a pivotal role in the pathogenesis of atherosclerosis and cardiovascular disease, with c-reactive protein (CRP) emerging as inflammatory biomarker in AMI [
14].
In addition to the above macromolecules, noncoding RNAs have recently received great attention for their potential as diagnostic biomarkers [
15]. MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression at a post-transcriptional level by repressing messenger RNA (mRNA) translation mainly via binding at the complementary 3′-untranslated region [
16]. It has been widely recognized that miRNAs can serve as vital players in many biological processes, especially in the cardiovascular diseases [
17]. Studies have shown that aberrant miRNAs expression closely related to AMI [
18], hypertension [
19], atherosclerosis [
20], heart failure [
21] and arrhythmias [
22]. miR-223 enhanced cardiac fibroblasts proliferation, migration, and differentiation, which led to cardiac fibrosis partially via the involvement of RASA1 [
23]. miR-133a plays an important role in atherosclerosis by attenuating lipid accumulation via TR4-CD36 pathway in macrophages [
24]. miRNA-499 levels were found to be linearly proportional to myocardial damage, with close relationship with AMI [
25]. Our previous work has identified miRNA-3113-5p as a novel cardio-miRNA that is significantly increased after cardiac ischemia-reperfusion (I/R) injury in cardiac and circulating levels and miRNA-3113-5p might serve as a stable marker for diagnosis of cardiac I/R injury [
26]. All these miRNAs have been identified as originating from the heart or being heart-resided, making them possible candidates for the diagnostic biomarkers of cardiovascular diseases. However, despite a large number of studies in identifying biomarkers to improve SCD diagnostic efficiency, few biomarkers have progressed to clinical use for SCD.
Given miRNAs’ stability and potential role in various cardiovascular events such as SCD, the aim of the present study is to investigate the value of four cardio-miRNAs (miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p) in discriminating SCD from controls. Our data showed that each of these miRNAs had considerable sensitivity when discriminating the SCD from non-cardiac deaths, and a combination of two of these miRNAs could further efficiently discriminate detailed causes of SCD.
Methods
Human heart samples
For the purpose of this study, we collected four categories of human heart samples that were autopsied at the Department of Forensic Medicine, School of Basic Medical Sciences, Gannan Medical University over the period 2012–2019. A total of 34 cases of subjects who died from SCD were selected. These cases included 18 of SCD-negative autopsy that presented none notable heart changes at autopsy and 16 of SCD with evidence of heart dysfunction (SCD-positive autopsy). The causes of SCD were made after systemic autopsy. SCD-negative autopsy was defined as sudden deaths without gross heart pathology, with or without histological evidence of early myocardial ischemia (i.e. wavy fiber, hyperesonophilia of cardiomyocytes, and contraction band necrosis). SCD-positive autopsy was defined as sudden deaths in clinic plus severe coronary artery stenosis at autopsy, often with gross or microscopic scarring within myocardium. In addition, 14 cases of fatal injury and 14 cases of carbon monoxide (CO) intoxication were selected as the year-matched control cases. In detail, the heart specimens from fatal injury served as negative control due to none myocardial ischemia in such conditions, and the heart specimens from acute CO intoxication were assigned as positive control due to the global, but not heart-restricted, deficiency of oxygen in such circumstances. Patients who had pre-operative chemo- or radiotherapy history were excluded. Any case with heart implantation was also excluded. All of these cases undergone autopsy examination and were also excluded from influence of other potential substances such as alcohol, illicit drugs, or psychoactive drugs. Detailed demographic and case information regarding the four categories of cases were documented in Table
1. Detailed heart pathology of the four groups of cases were recorded in Table
2. The use of human heart samples for the purpose of research was approved by the Ethical Review Board at the School of Basic Medical Sciences, Gannan Medical University.
Table 1
Basic information regarding the human fatal cases
CO intoxication | Positive control | 14 | 7/7 | 30.29 ± 3.11 | 7.29 ± 1.92 | 298.9 ± 32.71 | 1.58 ± 0.57 |
Fatal injury | Negative control | 14 | 9/5 | 45.00 ± 4.01** | 8.07 ± 1.96 | 312.5 ± 20.18 | 1.41 ± 0.65 |
SCD-positive autopsy | SCD | 16 | 14/2 | 62.69 ± 3.06***## | 3.75 ± 0.66# | 455.6 ± 10.49***### | 1.99 ± 0.93 |
SCD-negative autopsy | SCD | 18 | 14/4 | 42.11 ± 3.08*&&& | 5.50 ± 1.27 | 377.8 ± 27.32& | 1.89 ± 0.58 |
Table 2
Heart pathology in the SCD-negative autopsy, SCD-positive autopsy, and control groups (CO intoxication and fatal injury)
Total cases | n = 14 | n = 14 | n = 18 | n = 16 |
Heart pathology | No evident changes | No evident changes | ● 38.9% (7 cases) with both interstitial edema, wavy fibers, and hypereosinophilia of cardiomyocytes; ● 33.3% (6 cases) with only interstitial edema and patchy hypereosinophilic cardiomyocytes; ● 16.7% (3 cases) with interstitial edema and some slightly wavy fibers; ● 11.1% (2 cases) without evident gross or histological changes. | ● 56.2% (9 cases) with coronary stenosis (50–75% stenosis), calcification and myocardial fibrosis; ● 43.8% (7 cases) with coronary stenosis (> 75% stenosis), severe myocardial fibrosis and disorder. |
Histological evaluation
All histological evaluation was performed using the human heart samples dissected from the apex of each heart. Due to difficulty in obtaining fresh surgical heart samples, we used the autoptic formalin-fixed paraffin-embedded (FFPE) samples for the purpose of this study. Unlike mRNAs or proteins that are prone to degradation and chemical modification, miRNAs are very small in size (~ 22 nt), less likely to be degraded, and easier to recover from FFPE samples, all of which confer to miRNAs high forensic relevance [
27]. The extraction of miRNAs from autoptic FFPE samples was commonly documented in publications [
28]. After histological staining, independent pathologists were recruited to review the Hematoxylin & Eosin (H&E) staining sections and PicroSirius Red (PSR) staining sections using a multi-head microscope to result in consensus.
For the H&E staining, human heart tissues were immediately fixed in 4% paraformaldehyde for 24 h, followed by embedding in paraffin. Tissues were then sliced into 5 μm-thick heart slices. Then the slices were dewaxed and dehydrated in a gradient alcohol. Slices were then stained with hematoxylin solution for 10 min at room temperature and incubated in 1% hydrochloric-alcohol solution. Then, slices were washed using tap water, stained with eosin solution for 5 min, and separated by 75, 85, 90, 95 and 100% alcohol solutions for 2 min, respectively. Next, the slices were dried and sealed with neutral gums. After H&E staining, the morphological changes were observed and photographed under an optical microscope (Olympus, Tokyo, Japan).
For the PSR staining, human heart slices were deparaffinized to water and then immersed in 0.1% Sirius red staining solution dissolved in picric acid for 1 h. Then slices were washed in acidified water containing 1.5% hydrogen chloride, dehydrated and mounted. Collagen and non-collagen components were red- and orange-stained, respectively.
Immunohistochemistry (IHC) staining
Heart slices from the four categories were also subject to IHC analysis. Briefly, the slides were incubated in 3% H2O2 solution for 10 min and antigen retrieval was performed by steam heating in 10 mM citrate buffer (pH 6.0) for 30 min. After epitope recovery, the slides were then treated with 10% of normal goat serum for 60 min, followed by incubation with active caspase 3 antibody (1:500, Cell Signaling Technology, Catlog #9664, MA, USA), CD31 antibody (1:1000, Cell Signaling Technology, Catlog #3528), and CD68 antibody (1:500, Cell Signaling Technology, Catlog #76437) incubation overnight at 4 °C. The slides were washed and incubated with secondary horseradish peroxide (HRP)-linked secondary antibody (Vector Laboratories, MN, USA) at 1:500 dilutions for 1 h. The samples were treated with the chromogen DAB for antigen detection and the final counterstaining was performed with hematoxylin.
RNA extraction and reverse transcription
All paraffin was removed from the FFPE heart sections by treating with Deparaffinization Solution. The extraction of miRNAs from FFPE tissues was performed using a commercial miRNeasy FFPE kit (Qiagen, Catlog #217504, Hilden, Germany). Briefly, samples were incubated by heat treatment in an optimized lysis buffer, which contains proteinase K, to release RNAs from the sections. Supernatant was collected and treated with a DNase, followed by buffer RBC and ethanol treatments. The cleaned samples were then applied to an RNeasy MiniElute spin column, where the total RNAs including miRNAs, bound to the membrane and contaminants were efficiently washed away. Total RNAs including miRNAs were then eluted in a minimum of 14 μL of RNase-free water. Reverse transcription of the total RNA was performed using a Mir-X miRNA First-Strand Synthesis Kit (Takara, Tokyo, Japan) for RT-qPCR of miRNA. The synthesized cDNA was stored at − 80 °C for later use.
Real-time quantitative polymerase chain reaction (RT-qPCR)
QuantiFast Multiplex RT-PCR Kit (Qiagen) was used for RT-qPCR analysis. According to the kit instructions, an aliquot of 25 μL reaction system was mixed and amplified using the Applied Biosystem 7500 fluorescence quantitative PCR instrument (Darmstadt, Germany). Primers used for this study were listed in Table
3. The 2
-ΔCt method was used to calculate the relative expression of the target genes where ΔCt
miRNA = Ct
miRNA − C
thousekeeping.
Table 3
Primer sequences used in this study
hsa-miR-3113-5p | GTCCTGGCCCTGGTCCGGGTCC |
hsa-miR-499a-5p | TTAAGACTTGCAGTGATGTTT |
hsa-miR-223-3p | TGTCAGTTTGTCAAATACCCCA |
hsa-miR-133a-3p | TTTGGTCCCCTTCAACCAGCTG |
Statistical analysis
All data were expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed using independent Student’s t test. The diagnostic powers of miR-3113-5p, miR-223-3p, miR-133a-3p, and miR-499a-5p were evaluated by receiver operating characteristic (ROC) analysis. Areas under the curve (AUCs) were calculated. All statistical analyses were performed using GraphPad Prism 8.0 software (La Giolla, CA, USA). P < 0.05 was considered as statistically significant.
Discussion
Cardiovascular disease is still the main cause of morbidity and mortality worldwide. miRNAs play important roles in regulating cardiac development, remodeling and regeneration, endothelial function, vasculogenesis and neoangiogenesis through a variety of pathways [
32]. Aberrant miRNA expression profiles are associated with various cardiovascular conditions such as hypertrophy, fibrosis, heart failure, and arrhythmias [
33]. Studies have shown that miRNAs are circulating freely in mammalian blood with marked biostability and can be detected with high sensitivity and specificity in human plasma and serum [
34]. So, the diagnostic potential of miRNA detection in human plasma for cardiovascular disorders was to be explored. Coronary artery disease is the main cause of SCD. It was reported that the circulating miR-1 [
35] and miR-208a [
36] significantly increased in AMI patients compared to non-AMI controls, indicating miR-1 and miR-208a in serum may serve as biomarkers for AMI. miR-1 is also upregulated in the heart from patients with coronary artery disease and in rat ischemic hearts, which correlates to an increase in arrhythmogenesis [
37]. miR-135a increased and miR-147 decreased significantly in plasma of atherosclerotic cardiovascular diseases patients, and miR-135a/miR-147 ratio could be used for atherosclerotic cardiovascular diseases diagnosis [
38]. Circulating miR-106a may function as potential biomarker in patients with coronary artery disease [
39]. Although there has been many researches focusing on circulating/plasma biomarkers to enhance SCD risk prediction and diagnostic performance, few cardio-miRNAs have previously been identified, and none of these biomarkers have progressed to clinical use for SCD. Thus, there remains a critical need to identify biomarkers of SCD.
Several studies have reported that miR-223 is associated with myocardial diseases. miR-223-3p inhibits ischemia-reperfusion induced cardiac necroptosis at multiple layers which may constitute a new therapeutic agent for the treatment of ischemic heart disease [
30]. miR-223 was also shown to be downregulated in ET-1 induced hypertrophic myocardium by targeting TNNI3K [
40]. miR-223 was upregulated in a rat model of AMI and its overexpression promoted cardiac arrhythmias [
23]; thus, miR-223 may be a new target in the treatment of ischemic arrhythmias. Our previous research showed that cardiac miR-3113-5p might be a useful target for therapeutic purposes and circulating miR-3113-5p might serve as a stable marker for early diagnosis of cardiac ischemia-reperfusion injury [
26]. miR-499-5p is highly conserved and preferentially expressed in the myocardium [
41]; circulating levels of miR-499-5p were significantly higher at admission in AMI patients that died within the following year as compared to those who survived the cardiovascular event [
42]. Overexpression of miR-499-5p in cardiomyocytes was able to protect the heart against myocardial infarction-associated tissue damage in vivo [
43]. A study reported that miR-133a-3p inhibits cardiomyocyte apoptosis by targeting caspase-9 [
44], and miR-133a-3p has been implicated in the control of myocardial fibrosis [
45]. The above reports suggested these microRNAs had clinical importance in the diagnosis of SCD.
Many studies have recommended histological and IHC markers to be applied in the diagnosis of myocardial damage [
46‐
48]. Pertaining to the early myocardial damage, IHC staining has particular advantages due to their useful application in FFPE tissues and in assessing ischemic areas during acute myocardial ischemia [
46]. Unfortunately, a single immunohistochemical marker often cannot meet the requirements of diagnosis when no macroscopic or microscopic evidence of necrosis is available, and the IHC staining may be inevitably affected by sampling bias and interpretation controversy [
46‐
48]. In this study, immunohistochemical markers (cell apoptotic marker cl-Casp3, angiogenesis marker CD31, and macrophage infiltration marker CD68) were found to not aid in diagnosing SCD-negative autopsy. Small-molecules, namely the four cardio-miRNAs (miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p) were, however, found to be useful to diagnose SCD in human real cases. Our study demonstrated that miR-3113-5p, miR-223-3p, miR-499a-5p and miR-133a-3p may serve as candidate diagnostic biomarkers for SCD, allowing to distinguish subjects with SCD from others. The expression levels of miR-3113-5p, miR-223-3p, miR-499a-5p and miR-133a-3p were significantly up-regulated in the heart tissues from SCD as compared to control subjects. The ROC analysis revealed that the four miRNAs may serve as independent diagnostic markers of SCD. Among the miRNAs, miR-223-3p and miR-499a-5p showed better accuracy with the highest AUC values. In particular, we further found that several miRNA panels consisting two of the four miRNAs could achieve better discriminative capacity when discriminating the causes of SCD. These results showed that miR-3113-5p, miR-223-3p, miR-499a-5p, and miR-133a-3p may be considered as potential candidate biomarkers for diagnosis of SCD.
Previous studies have focused on circulating miRNAs that may be novel biomarkers for SCD-negative autopsy or SCD. For example, an elevated level of circulating miR-133a may serve as a diagnostic marker of AMI [
49]. Circulating miR-499 and miR-223 can effectively differentiate AMI from non-AMI patients [
50]. Unfortunately, these studies mainly focused on plasma or serum samples. The role of these miRNAs at their origin (cardiac-derived miRNAs, cardio-miRNAs) remained largely unknown. To this end, we used human heart samples to evaluate these cardio-miRNAs in SCD cases. Archival FFPE heart tissue samples are readily available resources for miRNA biomarker identification [
51]. It has been demonstrated that miR-1, miR-499, miR-133, and miR-208 are sensitive markers to diagnose SCD-negative autopsy and SCD using post-mortem FFPE heart tissues [
28], an observation that was also confirmed by the current study. In addition, our study represents the first one, to the best knowledge of us, to report the expression profiling of miR-3113-5p and miR-223-3p in FFPE heart tissues, and extended their biological importance as a diagnostic biomarker for SCD.
For a long time, the study of miRNAs could only be performed in model animals which was defected from clinical and forensic reality. The present study used FFPE tissues as a novel research material to maximally promote the findings conforming with human bodies. FFPE samples are valuable research materials, stored in pathology archives worldwide. Storing FFPE specimens is more economical than storing frozen samples, and the histological structure can be preserved almost permanently [
51]. However, formalin fixation and paraffin embedding inevitably lead to nucleic acids degradation in these tissues. DNA and RNA are fragmented and chemically modified [
52], which sometimes causes inconsistency between the results obtained using matched fresh and FFPE samples [
53]. Fortunately, miRNAs are robust and stable in FFPE heart tissues, which can be utilized as deep sequencing and quantitative qPCR analyses [
54]. A study has suggested that miRNAs remain highly stable in postmortem FFPE heart tissues, and validated that miR-1, miR-208b, and miR-499a in FFPE heart tissues are diagnostic biomarkers for SCD-negative autopsy patients [
28]. Therefore, we believe that the use of FFPE as a clinic relevant material opens novel insights into disease pathogenesis, particularly with regard to the identification of miRNAs.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.