Cryopreservation of human colorectal carcinomas prior to xenografting

Resection specimens of primary tumors (N = 48; primary CRCs without previous chemo-or radiotherapy) were received fresh from surgery. Tumor tissue cubes (ca. 3 × 3 × 3 mm) were cut from the deep invasive parts with a sterile scalpel blade.

Mirror blocks for cryostat sections were prepared from the adjacent parts of the tumours. Alternatively, xenograft tumors were removed under sterile conditions and pieces were taken from the peripheral parts of the tumors. Again, adjacent tumour tissues were used for cryostat sections. Typically, 4 tumor pieces were transferred into sterile cryo-tubes (greiner-bio-one, Frickenhausen, Germany) in 1.5 ml freezing medium (foetal calf serum containing 10% DMSO), sealed in a Freezing Container (Nalgene, Rochester, NY, USA), and placed immediately at -80°C. Until transplantation tubes were kept at -80°C (for a maximum of 6 weeks) or, after overnight cooling, transferred into liquid nitrogen (for longer storage periods). For xenografting, cryopreserved tumor pieces were thawed at 37°C. Prior informed consent was obtained in written from all patients, and all procedures were approved by the Ethics Committee of the University of Rostock (reference number II HV 43/2004) in accordance with generally accepted guidelines for the use of human material.

Tumor xenograftings were done by one of the following approaches: (I) xenografting of primaries on the day of surgery (n = 23); (II) xenografting of primaries after cryopreservation (n = 31); and (III) re-transplantation of xenografts after cryopreservation (n = 11). Tumor pieces were implanted subcutaneously uni-or bilaterally into the flanks of six to eight week old female mice under ether anaesthesia for a short period of time. We used NOD-SCID (NOD.CB17-Prkdcscid/J in cases of HROC24 to HROC46 and nude mice (NMRI nu/nu) for the subsequent xenograftings. As assessed by cryostat sections from the mirror blocks, there was seen an area fraction of 30 - 80% of viable tumour in the tissues used for xenografting. The numbers of mice receiving grafts and the numbers of grafts for each animal are given for each individual tumor in Table 1. Mice were kept in the animal facilities of the medical faculty of the University of Rostock and maintained in specified pathogen-free conditions. Animals were exposed to 12-h light/12-h darkness cycles and standard food and water including antibiotics (Co-trimoxazol) ad libitum. Their care and housing were in accordance with guidelines as put forth by the German Ethical Committee and the Guide for the Care and Use of Laboratory Animals (Institute of Laboratory Animal Resources, National Research Council; NIH Guide, vol.25, no.28, 1996). Growth of tumours to volumes of 1 - 1.5 cm³ was taken as evidence of successful xenografting, and the animals were then sacrificed for collection of tumour tissues for further studies.

Dissections and histopathological examination of the primary tumors were done according to standard protocols for surgical pathology reports of CRCs [10], and additional staging information was compiled from patients' clinical charts. Primary tumors and xenografts were embedded in paraffin, and 4 μm H&E sections were obtained as well as β-catenin and MLH1 and MSH2 immunostainings.

The molecular analyses were done as previously published in detail [2]. Briefly, the Bethesda panel of microsatellite markers was used to test for microsatellite instability, chromosomal instability was assessed by DNA-flow cytometry and LOH analyses with various dinucleotide markers (D5S1385, D5S346 (5q21); D8S1734, D8S1771, NEFL (8p21); D9S942, D9S1748 (9p21); D17S1832, D17S250 (17p23); D18S70 (18q23)), and mutation analyses of the APC gene as well as the K-Ras and B-Raf genes were done. Finally, DNA-methylation was assessed by the MethyLight technology with the marker panel originally published by Ogino et al. and modified by us [2]. Based on these molecular data, tumors in this series were classified as sporadic standard type CRC (spStdCRC), sporadic high-degree microsatellite instable CRC (spMSI-H), hereditary non-polyposis CRC-type (HNPCC-type), or CpG island methylator phenotype CRC (CIMP-type).

A human specific PCR was performed by amplification of a portion of the human mitochondrial cytochrome b gene as previously described [11]. Briefly, the reaction mixture (25 μl) contained 25 ng of gDNA, 0.1 mM of each primer (L15674: TAGCAATAATCCCCATCCTCCATATAT, H15782: ACTTGTCCAATGATGGTAAAAGG), 200 μM dNTPs, 1 × standard reaction buffer and 0.1 U Taq DNA polymerase (Bioron, Ludwigshafen, Germany). PCR was performed in a standard thermal cycler for 40 cycles of 30 s at 96°C, 40 s at 59°C, and 1 min at 72°C. Products were separated on a 1% agarose gel and results were scored positive with the appearance of a band of 157 bp.

All data were entered into a computerized data bank (Statistical Package for the Social Sciences, SPSS version 13.0). Testing for significance of cross-tabulated data was done by two-sided Fisher's exact T-test. The criterion for significance was taken to be p < 0.05.