Background
Recent studies indicate that behavioral hypersensitivity and neuronal hyperexcitability in the CNS in animal models of persistent pain are closely linked to long-lasting activation of descending modulatory circuits involving descending facilitation ([
1‐
5] See [
6‐
10] for reviews). It has been well established that the descending serotonin (5-HT) system from the rostral ventromedial medulla (RVM) of the brainstem is involved in the modulation of spinal nociceptive transmission [
11‐
14]. Selective lesions of spinal 5-HT fibers [
15] or molecular depletion of 5-HT in RVM neurons [
16] have been reported to attenuate behavioral hypersensitivity following injury. These effects of the descending 5-HT system resulted from the activation of diverse 5-HT receptor subtypes found in the spinal dorsal horn [
17‐
19]. 5-HT
3 receptors, the only ligand-gated cation channel with excitatory functions in the 5-HT receptor family, are expressed in spinal dorsal horn neurons and the central terminals of primary afferent neurons [
20,
21]. Spinal 5-HT
3 receptor-dependent descending pain facilitation has recently been implicated in the development of inflammatory and neuropathic pain [
5,
19,
22‐
25]. However, the signaling cascade underlying the contribution of spinal 5-HT
3 receptors to descending pain facilitation remains unclear.
Ample evidence suggests that glial cells in the spinal cord contribute to pain hypersensitivity after injury [
26‐
30]. In addition to glutamate, spinal neurons and the central terminals of primary afferents release chemokines, such as fractalkine (CX3CL1), activating nearby glial cells [
31,
32]. Furthermore, hyperactivated glia amplify neuronal excitability and facilitate nociceptive transmission in spinal cord via release of pro-inflammatory cytokines (e.g. IL-1β and TNF-α) [
33‐
35]. Increasing attention has been given to neuron-glia-neuron signaling as a driving force in the development and maintenance of persistent pain [
26‐
30].
Utilizing a model of 5-HT
3 receptor agonist-induced hyperalgesia, we tested the hypothesis that neuron-glial interactions involving chemokine/cytokine signaling molecules underlie mechanisms of pain hypersensitivity after spinal 5-HT
3 receptor activation. Our findings provide evidence that a spinal neuron-glia-neuron signaling cascade including endogenous fractalkine, the cytokines IL-18 and IL-1β, and neuronal GluN (NMDA) receptor activation, contribute to 5-HT
3 receptor-mediated hyperalgesia. Thus, spinal neuron-glial interactions underlying the development of hyperalgesia and allodynia not only depend on nociceptive drive from primary afferents after tissue and nerve injury [
35,
36], but also require maintenance of descending facilitation from RVM 5-HT-spinal 5-HT
3 receptor systems.
Discussion
Our findings demonstrate that a neuron-glia-cytokine-neuronal signaling cascade is involved in the mechanisms underlying spinal 5-HT
3 receptor-mediated hyperalgesia. The development of persistent pain after inflammation and nerve injury appears to be dependent, in part, upon 5-HT pathways originating from the rostral ventromedial medulla leading to activation of 5-HT
3 receptors at the spinal level [
5,
16,
19,
22,
24,
25,
37]. Consistent with these views and a recent study [
50], our data showed that blockade of spinal 5-HT
3 receptor function by intrathecal Y25130, a selective 5-HT
3 receptor antagonist, attenuated mechanical and thermal hypersensitivity following L5 SNL in rats. Interestingly, some studies reported that intrathecal injection of 5-HT
3 receptor antagonists such as CGP35348 [
51] or ondansetron [
52] had no preventive effects on mechanical allodynia and/or thermal hyperalgesia in a rat with L5/6 SNL, which conflicts with the study with the same drug ondansetron in the same SNL model [
50] and our results. However, we noticed that there were no expected plastic changes of both 5-HT immunoreactive intensity and 5-HT
3 receptor innervation in the lumbar spinal dorsal horn at 14 d after L5/L6 SNL in the study reported by Peters and colleagues [
52]. In contrast, we found a robust increase of tissue Tph-2 level in the RVM [
16] at 14 d and a progressive enhancement of tissue 5-HT
3 receptor expression in the spinal dorsal horn from 1 d to 28 d after nerve injury when compared with that in the sham group (unpublished observations). We suspect that the discrepancies between our positive findings and those reported by Peters et al. [
52] could be attributed to the utilization of different neuropathic pain models and different 5-HT
3 receptor antagonists as well as the absence of more quantitative measures used for the 5-HT
3 receptor expression and fewer time points measured after injury in their study. In the present study, our data indicate that the effective dose of intrathecal Y25130 for attenuation of behavioral hypersensitivity following SNL did not alter thermal and mechanical thresholds in the sham animals at 14 d after surgery. Thus, we propose that increased descending 5-HT drive and spinal 5-HT
3 receptor expression after tissue and nerve injury contribute to the maintenance of central sensitization, including glial hyperactivity and neuronal hyperexcitability at the spinal level underlying the development of persistent pain.
We have determined that a number of chemical mediators contribute to the spinal 5-HT
3 receptor-induced novel spinal signaling cascade that includes the chemokine, fractalkine released from 5-HT
3 receptor-containing neurons, cytokine IL-18 released from microglia, IL-1β released mainly from astrocytes, enhanced phosphorylation of spinal NMDA receptors, and ultimately behavioral hyperalgesia. Moreover, the mechanisms by which these events are sequentially activated through multiple signaling cascades to link neuron-microglia-astrocyte-neuronal interactions (Figure
8D) is unexpected and novel, and highlights how cellular circuitry and molecular signaling interact in the spinal dorsal horn response to 5-HT
3 receptor activation. The findings indicate that spinal hyperexcitability or central sensitization underlying the development of hyperalgesia not only depends on the initiation of nociceptive input from primary afferent neurons after tissue and nerve injury [
35‐
37], but also requires the maintenance of descending facilitation from the RVM 5-HT-spinal 5-HT
3 receptor systems [
25,
37]. Our study supports the growing evidence that spinal 5-HT
3 receptors play a crucial role in the cellular and molecular mechanisms of the development and maintenance of persistent pain states.
Our results demonstrate that there are at least three active signaling cascades, including fractalkine and its receptor, CX3CR1, for mediating spinal neuron-to-microglia signaling; IL-18 and its receptor for microglia-to astrocyte signaling; and IL-1β and its receptor for astrocyte-to-neuron signaling, as important components involved in the functional intercellular transduction in the dorsal horn after 5-HT
3 receptor activation. These findings do not rule out the role of other chemical mediators released from the same neurons, or different subpopulations of neurons (excitatory or inhibitory neurons) or glial cells in the regulation of spinal nociceptive processes. It has been reported that some central terminals of primary afferent neurons express 5-HT
3 receptors [
20,
21]. In a recent study, we also showed that 5-HT
3 receptors in the central terminals of primary afferent neurons are involved in enhanced primary nociceptive afferent activity and excitatory signaling input by increasing TRPV1 function during the maintenance of neuropathic pain [
25]. Intrathecal injection of 5-HT
3 receptor agonists may excite these central terminals to release fractalkine, glutamate and ATP, and directly activate glial cells and even directly enhance NMDA receptor function in dorsal horn neurons. Although these findings suggest other signaling cascades, the converging data in the present study suggest that spinal neuron-glia-neuronal interaction may be particularly important in the 5-HT
3 receptor-mediated central sensitization associated with intra-RVM 5-HT-dependent descending pain facilitation. Thus, up-regulation of 5-HT
3 receptor expression in the spinal dorsal horn, following enhanced descending 5-HT drive after nerve injury, may play an important role in glial hyperactivity involved in the maintenance of persistent pain.
Although spinal glial hyperactivity has been reported in acute and persistent pain models [
26,
29,
30,
53,
54], few studies have investigated the involvement of spinal 5-HT
3 receptors in spinal glial hyperactivity. In the present study, intrathecal injection of the selective activation of spinal 5-HT
3 receptors by intrathecal injection of the receptor agonist induced significant up-regulation of GFAP and Iba1. Although Western blot analysis did not show up-regulation of CD11b in the dorsal horn after single i.t. injection of SR57227, immunostaining for CD11b exhibited hypertrophic status of spinal microglia after SR57227, similar to Iba1 labeling. Interestingly, up-regulation of CD11b expression in spinal dorsal horn tissue was observed at 1d after hindpaw inflammation but not 2 h after intrathecal injection of SR57227, suggesting that increase of CD11b expression may require longer-lasting excitatory or nociceptive input on microglia. Molecular depletion of the descending 5-HT system significantly attenuated peripheral inflammation-produced glial hyperactivity in the spinal dorsal horn. These data provide the first evidence that either exogenous or endogenous activation of the 5-HT
3 receptor results in spinal glial hyperactivity. Moreover, we were interested in the mechanisms by which quiescent spinal glia alter their function in response to 5-HT
3 receptor activation. Recent studies have demonstrated special expression patterns for chemokines, cytokines and their receptors in spinal cord cells. For example, fractalkine exists in spinal neurons [
39,
40] and its receptor CX3CR1 is selectively expressed in microglia [
40,
55]. IL-18 and its receptor are present in spinal microglia and astrocytes, respectively [
43]. Consistent with our previous study on the RVM [
34,
56], we found that IL-1β is mainly expressed in astrocytes but not microglia in the spinal dorsal horn. Its receptor IL-1RI is present in dorsal horn neurons expressing GluNRs. These proteins have been demonstrated to play a role in spinal nociceptive modulation and the development of persistent pain after injury [
26,
27,
29,
30]. However, previous studies have not shown a relationship between these proteins and 5-HT
3 receptor activation in the spinal cord. In addition, extending our recent findings [
16,
35,
56], we showed the colocalization of IL-1RI with the GluNR subunit GluN1R in dorsal horn neurons and with IL-1RI-mediated facilitation of GluN1R phosphorylation after 5-HT
3 receptor activation. Thus, the IL-1β-mediated amplified signaling from spinal astrocytes further enhances neuronal excitability through signaling coupling with GluNRs in the spinal cord, which plays an important role in neuronal hypersensitivity. Our findings also suggest that activation of spinal 5-HT
3 receptor is sufficient to induce glial hyperactivity and cytokine release which are necessary for neuronal and behavioral hypersensitivity after 5-HT
3 receptor activation. The activated glia-mediated positive signaling amplification then sensitizes spinal nociceptive neurons, leading to further neuronal activation and behavioral hyperalgesia. These findings offer new insights into the cellular and molecular mechanisms in the spinal level responsible for descending pain facilitation during the development of persistent pain after tissue and nerve injury.
In the present study, we directly activated the spinal 5-HT
3 receptor to mimic 5-HT release through descending pain facilitation pathways [
16]. We found that intrathecal injection of 10 pmol of the 5-HT
3 receptor agonist SR 57227 produced thermal and mechanical hypersensitivity that lasted for 4 hours. This observation provides direct evidence that the spinal 5-HT
3 receptor plays a role in pain facilitation. Activation of 5-HT
3 receptors in the spinal cord by 5-HT is mediated by the descending excitatory drive from the RVM to the spinal cord [
5,
24,
37]. Consistent with studies with another 5-HT
3 receptor agonist 2-Me-5H [
57,
58], we found that intrathecal injection of higher doses of SR 57227 (10 nmol) induced transient analgesia. The different doses used in our experiments may reflect different mechanisms that depend on specific cellular circuits or the particular proteins involved. It has been shown that 5-HT
3 receptors are predominantly localized in terminals of excitatory axons in the rat superficial dorsal horn and some of these originate from dorsal horn neurons [
20,
21,
59,
60]. Although cell bodies expressing these receptors in the dorsal horn are further identified as excitatory neurons [
59,
61], some 5-HT
3 receptor-labeled neurons in rat dorsal horn express glutamate decarboxylase (GAD), a marker for GABAnergic neurons [
21]. Recent studies have demonstrated in the mouse that some dorsal horn neurons sensitive to 5-HT
3 receptor agonists were GAD positive [
62] and that some 5-HT
3 receptor mRNA-containing dorsal horn neurons were GAD positive [
63]. Thus, 5-HT
3 receptors appear to be expressed in both excitatory and inhibitory intrinsic neurons and terminals in the spinal dorsal horn. Synaptic plasticity of 5-HT
3 receptor expression and function in the spinal dorsal horn neurons and the terminals of primary afferent fibers during the development of persistent pain will require further study.
Methods
Animals
Adult male Sprague Dawley rats weighing 200–300 g (Harlan, Indianapolis, IN) were used in all experiments. Rats were on a 12 h light/dark cycle and received food and water ad libitum. The experiments were approved by the Institutional Animal Care and Use Committee of the University of Maryland Dental School.
Intrathecal injection
A lumber puncture procedure was adapted according to Hylden and Wilcox [
64]. Briefly, rats were anesthetized with 2–3% isoflurane in a gas mixture of 30% O
2 balanced with nitrogen and placed in a prone position on a styrofoam board with the forelimbs extended rostrally and the hind limbs hanging off the board. A portion of the caudal half of the rat’s back was shaved and scrubbed with providone-iodine solution. A disposable 25-gauge 1-inch needle connected to a 25-μl Luer tip Hamilton syringe was inserted slowly at the intervertebral space between the L4-L5 vertebra and the needle was allowed to penetrate the dura. A quick flick of the tail or a limb indicated entrance into the intrathecal space. Rats awoke within minutes upon the completion of intrathecal injection and termination of anesthesia.
Intra-RVM microinjection and gene transfer
For intra-RVM microinjection, under anesthesia with 3% isoflurane rats were placed in a Kopf stereotaxic instrument (Kopf Instruments). A midline incision was made after infiltration of lidocaine (2%) into the skin. A midline opening was made in the skull with a dental drill to insert a microinjection needle into the target site. The RVM is termed for collective structures that consist of the midline nucleus raphe magnus (NRM) and the adjacent gigantocellular reticular nucleus α part (NGCα). The coordinates for the NRM were as follows: 10.5 mm caudal to bregma, midline, and 9.0 mm ventral to the surface of the cerebellum [
65]. To avoid penetration of the transverse sinus, the incisor bar was set at 4.7 mm below the horizontal plane passing through the interaural line. Animals were subsequently maintained at 1% halothane. For gene transfer, as previously described (Wei et al., [
16]), microinjections of the plasmids were performed by delivering Suresilencing™ shRNA plasmid (TCAACATGCTCCATATTGAAT, 0.5 μg/0.5 μl; SuperArray, Frederick, MD, USA) slowly over a 10 min period using a 0.5 μl Hamilton syringe with a 32 gauge needle. The control group underwent identical procedures with injection of the same volume of scrambled shRNA plasmid (ggaatctcattcgatgcatac). Focal electroporation around the RVM area was delivered by seven square wave electric pulses (50 ms, 40 V, 1 Hz; model 2100; A-M Systems, Carlsborg, WA, USA). The wound was closed and the wound margins were covered with a local anesthetic ointment (Nupercainal; Rugby Laboratories), The animals returned to their cages after they recovered from anesthesia.
Pain models and behavioral testing
To establish a persistent pain model with L5 spinal nerve ligation (L5 SNL), rats were anesthetized with 2–3% isoflurane in a gas mixture of 30% O2 balanced with nitrogen, the left L5 spinal nerve was exposed and tightly ligated with 4–0 soft silk thread. Sham surgery was used as a control. To examine whether there were effects of descending 5-HT depletion on spinal glial hyperactivity induced by peripheral inflammation, complete Freund’s adjuvant (CFA, 50 μl, 25 μg Mycobacterium tuberculosis) was injected subcutaneously into the plantar surface of the left hindpaw at 3 d following gene transfer.
Animals were placed in clear plastic chambers on an elevated table and allowed to acclimate for approximately 30 min. Nociceptive responses to thermal and mechanical stimuli were measured. Thermal hyperalgesia was assessed by measuring the latency of paw withdrawal in response to a radiant heat source. A radiant heat stimulus was applied from underneath the glass floor with a high-intensity projector lamp bulb (8 V, 50 W; Osram, Berlin, Germany). The heat stimulus was focused on the plantar surface of each hindpaw, and the paw withdrawal latency (PWL) was determined by an electronic clock circuit. The bulb voltage was adjusted to derive a baseline withdrawal latency (10–12 s) in naive animals. A 20-s cutoff was used to prevent tissue damage. The PWL was tested for three trials with 5-min intervals between each trial. The average of the three trials was then determined. The mechanical sensitivity was measured with a series of calibrated von Frey filaments before and after gene transfer and tissue or nerve injury. An EF50 value was defined as the von Frey filament force (g) that produced a 50% frequency of the paw withdrawal responses and was used as a measure of mechanical sensitivity. Body weight and hindpaw diameters were determined before and after gene transfer as well as at 1 and 3 d after inflammation. All behavioral tests were conducted under blind conditions.
Intra-RVM electrical stimulation
Rats were anesthetized with 1.5% isoflurane and mounted in a stereotaxic apparatus. The stimulation site in the RVM was located stereotaxically as described above. A concentric bipolar stimulating electrode was introduced into the RVM. Trains (2 min on and 30 s off) of stimuli of 0.5 ms square wave pulse were applied with low (10 μA) or high (100 μA) intensity at 10 Hz for 15 min. The sham group received an electrode placement without stimulation. At 30 min after stimulation, sham and treated rats were anesthetized with 2% halothane and decapitated. The spinal dorsal horn tissues at L4-5 were removed for Western blot to examine the expression of CD11b and GFAP.
Immunohistochemistry
1 h, 2 h and 4 h after intrathecal injection of drugs, rats were deeply anesthetized with pentobarbital sodium (100 mg/kg, i.p.) and transcardially perfused with 200 ml normal saline followed by 500 ml 0.1 M phosphate buffer containing 4% paraformaldehyde (pH = 7.4). The lumber spinal cord was removed, post fixed, and transferred to 20% sucrose overnight. Transverse sections (free-floating, 20 to 40-μm) were cut with a cryostat. The free-floating sections were incubated with relevant antibodies with 1% normal goat sera and 0.3% Triton x-100 overnight at 4°C. After washes in PBS, the sections were incubated with relevant IgGs conjugated to Cy3 or Cy2 (1:500; Jackson ImmunoResearch, West Grove, PA) for 4 h at room temperature or overnight at 4°C. For the double immunofluorescent staining for IL-18 and NeuN, GFAP or Iba1, the tyramide signal amplification (PerkinElmer Life Sciences, Boston, MA) fluorescence procedures [
66] were used to detect staining for goat anti-IL-18 polyclonal antibody (1:10000; R & D Systems). Following washes, the stained sections were mounted on gelatin-coated slides and coverslipped with Vectashield (Vector Laboratories). Slides were examined with a Nikon fluorescence microscope and images were captured with a CCD Spot camera. A Bio-Rad laser scanning confocal microscope was also used for higher magnification and colocalization.
Western blot
Rats were sacrificed 1 h, 2 h and 4 h after intrathecal injection of drugs. The L5-6 spinal cord was rapidly removed and the dorsal half was separated and frozen on dry ice. The tissues were homogenized in solubilization buffer (50 mM Tris HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 1 mM Na3VO4, 1 U/ml aprotinin, 20 μg/ml leupetin, 20 μg/ml pepstatin A). The homogenate was centrifuged at 14,000 rpm for 10 min at 4°C. The supernatant was removed. The protein concentration was determined using a detergent-compatible protein assay with a bovine serum albumin standard. Each sample contains proteins from one animal. Protein samples (35 μg) were separated on 7.5% SDS-PAGE and blotted on a nitrocellulose membrane (GE Healthcare, Piscataway, NJ). The blots were blocked with 5% milk in Tris-buffered saline (TBS) for 30 min and then incubated with respective antibodies overnight at 4°C. The membrane was washed with TBS and incubated with anti-goat/mouse/rabbit IgG (1:1000; Santa Cruz Biotechnology, Santa Cruz, CA) for 1.5 h at room temperature. The immunoreactivity was detected using enhanced chemiluminescence (ECL; GE Healthcare). Some blots were further stripped in a stripping buffer (Thermo Scientific) for 30 min at 50°C. The loading and blotting of equal amount of protein were verified by reprobing the membrane with anti-β-actin antiserum (Sigma). Specific expression band for the targeted proteins was identified with the marker bands for the expected molecular weight (KDa).
Data analysis
Data were presented as means ± SEM, and analyzed using one- or two.-way ANOVA. The significant differences between the groups were determined by a post-hoc test. P < 0.05 is considered significant for all cases. For Western blot analysis, the ECL-exposed films were digitized and immunoreactive bands were quantified by U-SCAN-IT gel (version 4.3; Silk Scientific, Orem, UT). The relative protein levels were obtained by comparing the respective specific band to the β-actin control from the same membrane. The deduced ratios were further normalized to that of the naive rats on the same membrane and illustrated as the percentage of the naive controls. Raw data (ratios of the respective band over β-actin) were used for statistical comparisons.
Drugs and antibodies
The following drugs were used for intrathecal injection: 5-HT3 receptor agonist SR-57227 hydrochloride (TOCRIS, Ellisvlle, MO), 5-HT3 receptor antagonist Y-25130 (TOCRIS, Ellisvlle, MO), fractalkine (aa 22–100, R & D Systems), neutralizing antibody against rat CX3CR1 (CX3CR1 Ab, Torrey Pines Biolabs, Houston, TX) and IL-1β receptor (IL-1ra, Amgen, Thousand Oaks, CA), anti-IL-18 receptor (IL-18R Ab, R & D Systems), recombinant rat IL-18 (R&D systems) and IL-1β (PeproTech).
The following antibodies were used for western blot and immunohistochemistry: The polyclonal primary antibodies were used in the following dilutions: anti-5-HT3 receptor (1:500, Calbiochem, Gibbstown, NJ), anti-glial fibrillary acidic proteins (GFAP,1:10000, Millipore, Bedford, MA; or 1:1000, Chemicon, Temecula, CA), anti-S100β (1:1000, Millipore, Bedford, MA), anti-Iba1 (1:1000; Wako, Osaka, Japan), anti-fractalkine (1:1000) (Novus Biological, Littleton, CO), anti-CX3CR1 (1:1000, Torrey Pines Biolabs, Houston, TX), anti-IL-18 (1:400, R & D Systems), anti-IL-18R (1:500, R & D Systems), anti-IL-1β (1:500, Endogen, Rockford, IL), anti-IL-1R (1:500, Santa Cruz Biotechnology), and anti-p-GluN1 (or NR1) ser896 (1:1000, Millipore, Bedford, MA). The monoclonal primary antibodies were used in the following dilutions: anti-CD11b (clone OX-42, 1:1000, Serotec, Raleigh, NC), anti-NeuN, (1:1000, Millipore, Bedford, MA; or 1:2000, Chemicon), anti-GluN1 (1:1000, Millipore) and anti-β-actin (Sigma-Aldrich).
Competing interests
The authors declare that they have no competing interest.
Authors’ contribution
WG contributed to western blotting analysis and behavioral tests, analyzed and interpreted data; KM contributed to IHC studies; RD designed research, participated in interpretation and revised the manuscript. MG contributed to IHC, western blotting and behavioral experiments, analyzed and interpreted data; ML carried out western blotting and behavioral experiments; JL carried out IHC and behavioral experiments; SZ carried out behavioral tests; KR designed research and interpreted data; KN participated in data analysis and interpretation; FW contributed to the conception and design of the studies, analysis and interpretation of data, writing and revising the manuscript. All authors read and approved the final manuscript.