Skip to main content
Erschienen in: Journal of Translational Medicine 1/2017

Open Access 01.12.2017 | Commentary

Genetic instability and increased mutational load: which diagnostic tool best direct patients with cancer to immunotherapy?

verfasst von: Giuseppe Palmieri, Maria Colombino, Antonio Cossu, Antonio Marchetti, Gerardo Botti, Paolo A. Ascierto

Erschienen in: Journal of Translational Medicine | Ausgabe 1/2017

download
DOWNLOAD
print
DRUCKEN
insite
SUCHEN

Abstract

The occurrence of high rates of somatic mutations in cancer is believed to correspond to increased frequency of neo-epitope formation and tumor immunogenicity. Thus, classification of patients with cancer according to degree a somatic hyper-mutational status could be proposed as a predictive biomarker of responsiveness to immunotherapy with immune checkpoint inhibitors. Here, we discuss the suitable and reliable tests easily adoptable in clinical practice to assess somatic mutational status in patients with advanced cancer.
Abkürzungen
CRC
Colorectal cancer
CTLA-4
cytotoxic T-lymphocyte antigen-4
MMR
mismatch repair
MSI
microsatellite instability
MSS
Microsatellite stability
PCR
polymerase chain reaction
PD-1
programmed cell death-1
Recently, the load of non-synonymous sequence variants has been significantly associated with clinical benefit from treatment of patients with cancer with immune checkpoint inhibitors In particular, cancer types associated with chronic exposure to external mutagens (i.e. ultraviolet radiations for melanoma or carcinogens and environmental pollutants for lung cancer) or constitutive impairment in genomic integrity (i.e. defective DNA repair mechanisms in a subset of colon cancer) have been reported to preferentially respond to immune checkpoint inhibitors [14]. In these conditions, high frequency of mutations seems to determine a higher occurrence of neo-epitope formation and, thus, tumor immunogenicity [5]. Therefore, classification of cancer patients according to their somatic mutational status could be being proposed as a predictive biomarker of responsiveness to anti-cytotoxic T-lymphocyte antigen-4 (CTLA-4) [4] and programmed cell death-1 (PD-1) [3] antibodies.
Although qualitative mutation data on somatic cancer samples are still limited, research efforts aim at defining whether the increased load of the non-synonymous sequence variants may follow distinct mutational patterns or rather represent the consequence of the accumulation of mutations in specific pathways [6, 7]. Detection of specific mutations associated with the response to immunotherapy could pave the way to the development of affordable qualitative biomarkers (presence vs. absence) compared to threshold-depending quantitative parameters. Mutation frequency can be accurately analyzed on tumor tissue samples by next-generation sequencing NGS). Unfortunately, this methodology successfully used for research purposes (indeed, they are now commonly taken into account in vast majority of recently-approved clinical trials) remain, too far away from the practicality of clinical use due to the technical difficulties and necessary expertise usually not available in clinical oncology laboratories.
While in the future NGS may cross the threshold of clinical application, what can be done in the meanwhile?
The following pressing question arises: does a reliable and simple diagnostic test exist ready for use in clinical practice for the assessment of a somatic mutational status?
To date, only the selective identification of patients carrying tumors with genomic instability is practically achievable. The occurrence of alterations impairing the mechanisms involved in maintenance of the genome integrity may induce progressive accumulation of genetic DNA errors and provide a selective advantage for cancer cells during malignant evolution. It has been long known that tumors with non-functional DNA mismatch repair (MMR) present with a higher tendency to bear DNA genomic errors and display a pattern of genomic instability [8]. An efficient MMR apparatus is indeed required for accurate DNA replication during cell proliferation, whereas defects result in increased DNA mutation rates. Microsatellite instability (MSI) inferred by detection of ubiquitous somatic variation in length of microsatellite sequences in tumor DNA compared to the corresponding normal DNA [8, 9], is indicative of inactivating alterations in mismatch repair genes in many unrelated tumor types. The highest prevalence of MSI has been reported in colorectal cancer (ranging from 10 to 15% in sporadic and 70 to 90% in hereditary non-polyposis colon carcinomas, but rarely seen in rectal cancers). Among extra-colonic malignancies, MSI has been described in endometrial (accounting for 20–30% of cases), small bowel (15–25%), gastric (10–20%), ovarian (8–12%), gallbladder (5–8%), prostate (3–8%) cancers as well as in melanoma (varying from 2 to 30% in primary tumors and 20% to up to 70% in metastatic lesions) in Western countries [10, 11].
Considering recent results about the efficacy of the PD-1 inhibitors according to the microsatellite status, the response rate in the MMR proficient colorectal cancer (CRC) and non-CRC cohorts was overall 1% (1/79), with a disease control rate of 13% (10/79) [4, 1215]. Conversely, the MMR deficient CRC and non-CRC cohorts presented response rates of 58% (15/26) and 55% (12/22), respectively, and disease control rates of 88% (23/26) and 77% (17/22) [4, 1215]. Further studies on immune checkpoint inhibitors, as single agents or in combination, in expanded cohorts of cancer patients evaluated for MSI are ongoing.
Genetic (allelic deletions, as indicated by loss of heterozygosis in tumor DNA, and/or gene mutations) or epigenetic (functional silencing through promoter hyper-methylation) inactivation of both alleles of the MMR genes leads to MSI at somatic level. The MMR system is composed of 6 MMR genes and their encoded proteins (MLH1, MSH2, MSH3, MSH6, MLH3, PMS2), though inactivation of MLH1 and MSH2 account for over 85% of MSI cases [16].
A correlation between presence of MSI and abnormal MMR gene expression has been widely reported [1719], strongly suggesting that detection of the MMR proteins could represent a surrogate approach for the identification of tumors with genetic instability. Immunohistochemistry is usually conducted for the main MMR gene products, MLH1 and MSH2, failing thus to ensure full coverage of all MSI cases. Combination of microsatellite analysis and immune histochemical staining for MMR gene products better define the so-called mutator phenotype, most prominently associated with increased DNA mutation rates. In our experience, data from immunohistochemistry using both anti-MLH1 and anti-MSH2 antibodies revealed absent protein expression in about two-thirds of the MSI tumors (either colorectal or endometrial carcinomas) [2024]. As mentioned above, the MSI tumors present a genomic instability at somatic level due to nonfunctional DNA mismatch repair. Overall, concordance between down-regulation of MLH1/MSH2 gene expression and microsatellite instability varies from 68% to more than 80%, with an average of 75% [19, 25, 26]. One could speculate that lack of complete concordance could be due to various factors: (a) the absence of protein expression requires the inactivation of both alleles of the MMR genes, but the occurrence of deleterious mutations altering MMR gene activity may equally affect the functional mechanisms of DNA repair without impairing protein expression; (b) additional genes may be implicated in defects of replication fidelity (c) staining can be heterogeneous throughout tumor samples, and scoring may not be readily reproducible, particularly in the absence of convincing positive internal control. However, the sensitivity for detection of defective MMR is increased when all four MMR proteins are tested [27].
Collating these findings, it becomes evident that MSI might be considered the only reliable marker of replication errors in human cancers and that a well-conducted microsatellite analysis may yield an accurate detection of genetic instability. MSI testing by polymerase chain reaction (PCR) is considered the gold standard allowing the identification of abnormalities even in the setting of non-truncating protein mutations. For this purpose, a recommended reference panel by the National Cancer Institute (Bethesda panel assay) exists and comprises two mononucleotide repeats (BAT-25 and BAT-26) and three dinucleotide repeats (D5S346, D2S123 and D17S250) (Table 1) [28]. Although classification also includes the low-frequency MSI group (if only one of five markers shows instability), presence of MSI should be defined by PCR-based detection of at least two unstable (due to deletions or insertions) microsatellite markers in tumor DNA compared to normal DNA. In Fig. 1, representative examples of microsatellite features are shown. In addition to the amplification of the five polymorphic microsatellite loci of the Bethesda panel assay using 5′ fluorescent labeled primers, according to ThermoFisher Scientific (Waltham, MA, USA) guidelines, a second PCR-based fluorescent multiplex assay which may be reliably used in clinical practice to test MSI is actually represented by the MSI Analysis System, Version 1.2 (Promega Corp., Madison, WI, USA), analyzing seven microsatellite markers (mononucletide repeats: BAT-25, BAT-26, NR-21, NR-24, and MONO-27; pentanucleotide repeats: Penta C and Penta D). In both cases, the PCR products are separated by capillary electrophoresis using an automated sequencer (i.e. 3100 or 3500 Series Genetic Analyzers by ThermoFisher Scientific) and the output data analyzed with specific software (i.e. GeneMapper Analysis Software by ThermoFisher Scientific) to determine MSI status. The PCR-based multiplex assay is also relatively inexpensive (less than 50 euros per patient’s classification) as compared to the four-five fold higher costs of developing NGS-based methodologies.
Table 1
Sequence repeats at the five marker loci commonly used for PCR-based microsatellite analysis
Marker
Chromosome location
Gene location
Microsatellite repeat unit
Oligonucleotide primers
Amplicon lenght (bp)
BAT25
4p12
cKIT
Mononucleotide
Forward
TCGCCTCCAAGAATGTAAGT
118–123
Reverse
TCTGCATTTTAACTATGGCTC
BAT26
2p16.3–p21
hMSH2
Mononucleotide
Forward
TGACTACTTTTGACTTCAGCC
109–114
Reverse
AACCATTCAACATTTTTAACCC
D2S123
2p16
hMSH2
Dinucleotide
Forward
AAACAGGATGCCTGCCTTTA
197–227
Reverse
GGACTTTCCACCTARGGGAC
D5S346
5q21/22
APC
Dinucleotide
Forward
ACTCACTCTAGTGATAAATCGGG
96–122
Reverse
AGCAGATAAGACAGTATTACTAGTT
D17S250
17q11.2–q12
BRCA1
Dinucleotide
Forward
GGAAGAATCAAATAGACAAT
151–169
Reverse
GCTGGCCATATATATATTTAAACC
bp base pairs
While waiting for the application in clinical practice of NGS technology, the standardization of screening approaches based on unique microsatellite panels will improve the classification of genetic instability. This might represent an opportunity to select more homogeneous subsets of unstable patients with a higher mutational load allowing a more accurate assessment of the predictive role of increased mutation rates.

Authors’ contributions

GP conceived of the study and drafted the manuscript. MC, AC, and GB participated in data analysis. AM helped to draft the manuscript. PAA participated in the design of the study and its coordination. All authors read and approved the final manuscript.

Acknowledgements

Authors are grateful to Maria Giglio and Francesco Rassu for their supporting assistance in this study.

Competing interests

Paolo A. Ascierto has/had consultant and advisory role for Bristol Myers Squibb, Merck Sharp & Dohme, Roche-Genenetech, Novartis, Amgen, Array, Merck-Serono, and Pierre Fabre. He received research fund from Bristol Myers Squibb, Roche-Genetech, and Array. All the remaining authors declare the absence of any competing interests.

Availability of data and materials

Data sharing not applicable to this article as no datasets were generated or analyzed during the current study.

Funding

Work was partially supported by Sardinian Regional Government (Regione Autonoma della Sardegna), Progetto RAS CRP-59690.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
2.
Zurück zum Zitat Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science. 2015;348:124–8.CrossRefPubMedPubMedCentral Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer. Science. 2015;348:124–8.CrossRefPubMedPubMedCentral
4.
5.
Zurück zum Zitat McGranahan N, Furness AJS, Rosenthal R, et al. Clonal neoantigens elicit T cell immunoreactivity and sensitivity to immune checkpoint blockade. Science. 2016;351:1463–9.CrossRefPubMedPubMedCentral McGranahan N, Furness AJS, Rosenthal R, et al. Clonal neoantigens elicit T cell immunoreactivity and sensitivity to immune checkpoint blockade. Science. 2016;351:1463–9.CrossRefPubMedPubMedCentral
6.
Zurück zum Zitat Hugo W, Zaretsky JM, Sun L, et al. Genomic and transcriptomic features of response to anti-PD-1 therapy in metastatic melanoma. Cell. 2016;165:35–44.CrossRefPubMed Hugo W, Zaretsky JM, Sun L, et al. Genomic and transcriptomic features of response to anti-PD-1 therapy in metastatic melanoma. Cell. 2016;165:35–44.CrossRefPubMed
7.
Zurück zum Zitat Zaretsky JM, Garcia-Diaz A, Shin DS, et al. Mutations associated with acquired resistance to PD-1 blockade in melanoma. N Engl J Med. 2016;375:819–29.CrossRefPubMed Zaretsky JM, Garcia-Diaz A, Shin DS, et al. Mutations associated with acquired resistance to PD-1 blockade in melanoma. N Engl J Med. 2016;375:819–29.CrossRefPubMed
8.
Zurück zum Zitat Lengauer C, Kinzier KW, Volgestein B. Genetic instabilities in human cancers. Nature. 1998;396:643–9.CrossRefPubMed Lengauer C, Kinzier KW, Volgestein B. Genetic instabilities in human cancers. Nature. 1998;396:643–9.CrossRefPubMed
9.
Zurück zum Zitat Sturzeneker R, Bevilacqua RA, Haddad LA, Simpson AJ, Pena SD. Microsatellite instability in tumors as a model to study the process of microsatellite mutations. Hum Mol Genet. 2000;9:347–52.CrossRefPubMed Sturzeneker R, Bevilacqua RA, Haddad LA, Simpson AJ, Pena SD. Microsatellite instability in tumors as a model to study the process of microsatellite mutations. Hum Mol Genet. 2000;9:347–52.CrossRefPubMed
11.
Zurück zum Zitat Lee V, Murphy A, Le DT, Diaz LA Jr. Mismatch repair deficiency and response to immune checkpoint blockade. Oncologist. 2016;21:1200–11.CrossRefPubMed Lee V, Murphy A, Le DT, Diaz LA Jr. Mismatch repair deficiency and response to immune checkpoint blockade. Oncologist. 2016;21:1200–11.CrossRefPubMed
12.
Zurück zum Zitat Graff JN, Alumkal JJ, Drake CG, et al. Early evidence of anti-PD-1 activity in enzalutamide-resistant prostate cancer. Oncotarget. 2016;33:52810–7. Graff JN, Alumkal JJ, Drake CG, et al. Early evidence of anti-PD-1 activity in enzalutamide-resistant prostate cancer. Oncotarget. 2016;33:52810–7.
13.
Zurück zum Zitat Jin Z, Yoon HH. The promise of PD-1 inhibitors in gastro-esophageal cancers: microsatellite instability vs. PD-L1. J Gastrointest Oncol. 2016;7:771–88.CrossRefPubMedPubMedCentral Jin Z, Yoon HH. The promise of PD-1 inhibitors in gastro-esophageal cancers: microsatellite instability vs. PD-L1. J Gastrointest Oncol. 2016;7:771–88.CrossRefPubMedPubMedCentral
14.
Zurück zum Zitat Le DT, Uram JN, Wang H, et al. PD-1 blockade in mismatch repair deficient non-colorectal gastrointestinal cancers. J Clin Oncol. 2016;34 (abstr):195. Le DT, Uram JN, Wang H, et al. PD-1 blockade in mismatch repair deficient non-colorectal gastrointestinal cancers. J Clin Oncol. 2016;34 (abstr):195.
15.
Zurück zum Zitat Sehdev A, Cramer HM, Ibrahim AA, Younger AE, O’Neil BH. Pathological complete response with anti-PD-1 therapy in a patient with microsatellite instable high, BRAF mutant metastatic colon cancer: a case report and review of literature. Discov Med. 2016;21:341–7.PubMed Sehdev A, Cramer HM, Ibrahim AA, Younger AE, O’Neil BH. Pathological complete response with anti-PD-1 therapy in a patient with microsatellite instable high, BRAF mutant metastatic colon cancer: a case report and review of literature. Discov Med. 2016;21:341–7.PubMed
16.
17.
Zurück zum Zitat Chaves P, Cruz C, Lage P, et al. Immunohistochemical detection of mismatch repair gene proteins as a useful tool for the identification of colorectal carcinoma with the mutator phenotype. J Pathol. 2000;191:355–60.CrossRefPubMed Chaves P, Cruz C, Lage P, et al. Immunohistochemical detection of mismatch repair gene proteins as a useful tool for the identification of colorectal carcinoma with the mutator phenotype. J Pathol. 2000;191:355–60.CrossRefPubMed
18.
Zurück zum Zitat Sameer AS, Nissar S, Fatima K. Mismatch repair pathway: molecules, functions, and role in colorectal carcinogenesis. Eur J Cancer Prev. 2014;23:246–57.CrossRefPubMed Sameer AS, Nissar S, Fatima K. Mismatch repair pathway: molecules, functions, and role in colorectal carcinogenesis. Eur J Cancer Prev. 2014;23:246–57.CrossRefPubMed
19.
Zurück zum Zitat Goodfellow PJ, Billingsley CC, Lankes HA, et al. Combined microsatellite instability, MLH1 methylation analysis, and immunohistochemistry for Lynch Syndrome screening in endometrial cancers from GOG210: an NRG Oncology and Gynecologic Oncology Group Study. J Clin Oncol. 2015;33:4301–8.CrossRefPubMedPubMedCentral Goodfellow PJ, Billingsley CC, Lankes HA, et al. Combined microsatellite instability, MLH1 methylation analysis, and immunohistochemistry for Lynch Syndrome screening in endometrial cancers from GOG210: an NRG Oncology and Gynecologic Oncology Group Study. J Clin Oncol. 2015;33:4301–8.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Baldinu P, Cossu A, Manca A, et al. Microsatellite instability and mutation analysis of candidate genes in unselected Sardinian patients with endometrial cancer. Cancer. 2002;94:3157–68.CrossRefPubMed Baldinu P, Cossu A, Manca A, et al. Microsatellite instability and mutation analysis of candidate genes in unselected Sardinian patients with endometrial cancer. Cancer. 2002;94:3157–68.CrossRefPubMed
21.
Zurück zum Zitat Colombino M, Cossu A, Manca A, et al. Prevalence and prognostic role of microsatellite instability in patients with rectal carcinoma. Ann Oncol. 2002;13:1447–53.CrossRefPubMed Colombino M, Cossu A, Manca A, et al. Prevalence and prognostic role of microsatellite instability in patients with rectal carcinoma. Ann Oncol. 2002;13:1447–53.CrossRefPubMed
22.
Zurück zum Zitat Colombino M, Cossu A, Arba A, et al. Microsatellite instability and mutation analysis among Southern Italian patients with colorectal carcinoma: detection of different alterations accounting for MLH1 and MSH2 inactivation in familial cases. Ann Oncol. 2003;14:1530–6.CrossRefPubMed Colombino M, Cossu A, Arba A, et al. Microsatellite instability and mutation analysis among Southern Italian patients with colorectal carcinoma: detection of different alterations accounting for MLH1 and MSH2 inactivation in familial cases. Ann Oncol. 2003;14:1530–6.CrossRefPubMed
23.
Zurück zum Zitat Strazzullo M, Cossu A, Baldinu P, et al. High-resolution methylation analysis of hMLH1 promoter in sporadic endometrial and colorectal carcinomas. Cancer. 2003;98:1540–6.CrossRefPubMed Strazzullo M, Cossu A, Baldinu P, et al. High-resolution methylation analysis of hMLH1 promoter in sporadic endometrial and colorectal carcinomas. Cancer. 2003;98:1540–6.CrossRefPubMed
24.
Zurück zum Zitat Colombino M, Cossu A, Budroni M, et al. Identification of predictive factors for the occurrence of predisposing MLH1 and MSH2 germline mutations among Sardinian patients with colorectal carcinoma. Eur J Cancer. 2005;41:1058–64.CrossRefPubMed Colombino M, Cossu A, Budroni M, et al. Identification of predictive factors for the occurrence of predisposing MLH1 and MSH2 germline mutations among Sardinian patients with colorectal carcinoma. Eur J Cancer. 2005;41:1058–64.CrossRefPubMed
25.
Zurück zum Zitat Leite M, Corso G, Sousa S, et al. MSI phenotype and MMR alterations in familial and sporadic gastric cancer. Int J Cancer. 2011;128:1606–13.CrossRefPubMed Leite M, Corso G, Sousa S, et al. MSI phenotype and MMR alterations in familial and sporadic gastric cancer. Int J Cancer. 2011;128:1606–13.CrossRefPubMed
26.
27.
Zurück zum Zitat Shia J. Immunohistochemistry versus microsatellite instability testing for screening colorectal cancer patients at risk for hereditary nonpolyposis colorectal cancer syndrome. Part I. The utility of immunohistochemistry. J Mol Diagn. 2008;10:293–300.CrossRefPubMedPubMedCentral Shia J. Immunohistochemistry versus microsatellite instability testing for screening colorectal cancer patients at risk for hereditary nonpolyposis colorectal cancer syndrome. Part I. The utility of immunohistochemistry. J Mol Diagn. 2008;10:293–300.CrossRefPubMedPubMedCentral
28.
Zurück zum Zitat Umar A, Boland CR, Terdiman JP, et al. Revised Bethesda Guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. J Natl Cancer Inst. 2004;96:261–8.CrossRefPubMedPubMedCentral Umar A, Boland CR, Terdiman JP, et al. Revised Bethesda Guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. J Natl Cancer Inst. 2004;96:261–8.CrossRefPubMedPubMedCentral
Metadaten
Titel
Genetic instability and increased mutational load: which diagnostic tool best direct patients with cancer to immunotherapy?
verfasst von
Giuseppe Palmieri
Maria Colombino
Antonio Cossu
Antonio Marchetti
Gerardo Botti
Paolo A. Ascierto
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Journal of Translational Medicine / Ausgabe 1/2017
Elektronische ISSN: 1479-5876
DOI
https://doi.org/10.1186/s12967-017-1119-6

Weitere Artikel der Ausgabe 1/2017

Journal of Translational Medicine 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Erhebliches Risiko für Kehlkopfkrebs bei mäßiger Dysplasie

29.05.2024 Larynxkarzinom Nachrichten

Fast ein Viertel der Personen mit mäßig dysplastischen Stimmlippenläsionen entwickelt einen Kehlkopftumor. Solche Personen benötigen daher eine besonders enge ärztliche Überwachung.

Nach Herzinfarkt mit Typ-1-Diabetes schlechtere Karten als mit Typ 2?

29.05.2024 Herzinfarkt Nachrichten

Bei Menschen mit Typ-2-Diabetes sind die Chancen, einen Myokardinfarkt zu überleben, in den letzten 15 Jahren deutlich gestiegen – nicht jedoch bei Betroffenen mit Typ 1.

15% bedauern gewählte Blasenkrebs-Therapie

29.05.2024 Urothelkarzinom Nachrichten

Ob Patienten und Patientinnen mit neu diagnostiziertem Blasenkrebs ein Jahr später Bedauern über die Therapieentscheidung empfinden, wird einer Studie aus England zufolge von der Radikalität und dem Erfolg des Eingriffs beeinflusst.

Costims – das nächste heiße Ding in der Krebstherapie?

28.05.2024 Onkologische Immuntherapie Nachrichten

„Kalte“ Tumoren werden heiß – CD28-kostimulatorische Antikörper sollen dies ermöglichen. Am besten könnten diese in Kombination mit BiTEs und Checkpointhemmern wirken. Erste klinische Studien laufen bereits.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.