Background
The blood–brain barrier (BBB) of the central nervous system (CNS) is a specialised vascular structure that is essential for normal brain function and homeostasis (see [
1] for review). It is composed of brain endothelial cells (BEC), pericytes, and astrocyte endfeet that are embedded in a network of extracellular matrix (ECM) molecules that form the basement membrane of the cerebrovasculature (see [
2,
3] for review). In a physiological state, BBB integrity is essential to protect brain tissue from blood-derived toxins and to limit circulating immune cell infiltration whilst allowing selective transport of nutrients that are essential for neuronal activity. BBB integrity is primarily maintained by close interaction of BEC triggered by tight junctions that restrict paracellular transport. Tight junctions are composed of cell surface proteins including occludins and claudins that interact in a homodimeric fashion, as well as intracellular adaptor proteins such as zona occludens-1 (ZO-1). Integrity of the BBB is also maintained by attachment of BEC to blood vessel basement membrane, the latter being composed of large glycoprotein ECM molecules such as fibronectin (FN), collagen (Col) IV, and laminin (LM) isoforms, of which LM 8 (α4β1γ1) and LM 10 (α5β1γ1) are primarily found in the basement membrane of the cerebrovasculature [
4,
5]. BEC interaction with the basement membrane occurs via integrins, the major cell surface adhesion molecules responsible for anchoring endothelial cells to the ECM [
3,
6] that are also critically involved in the interaction between the basement membrane and astrocyte endfeet, thereby further contributing to BBB integrity [
3].
In contrast, acute CNS disorders, such as cerebral ischaemia, result in loss of BBB integrity, which is known to contribute to brain injury and is associated with poor outcome [
7]. Key events associated with BBB dysfunction include rapid degradation of ECM molecules, loss of interaction between endothelial cells and the basement membrane, and disruption of tight junctions, leading to a leaky BBB that allows extravasation of systemic circulating blood-derived molecules and leucocytes [
8]. These events are also associated with cerebrovascular inflammation primarily driven by the pro-inflammatory cytokine interleukin-1 (IL-1). IL-1 induces endothelial cell activation [
9] and neutrophil infiltration [
10], which contributes to neuronal injury. However the precise events that cause BBB dysfunction are unclear, and it is unknown whether IL-1 directly contributes to these events. Degradation of the ECM network following injury is followed by synthesis and deposition of de novo expressed ECM molecules, which is associated with ECM remodelling and BBB repair mechanisms post injury, although the mechanisms involved and the specific contribution of ECM to BBB repair are completely unknown. Using an in vitro BBB model, we demonstrate that oxygen-glucose deprivation (OGD) and IL-1 are key triggers for BBB dysfunction as well as de novo expression of ECM molecules and that LM10 is a key ECM molecule involved in BBB repair.
Methods
Mouse LM (isoform -8 (α4β1γ1) and -10 (α5β1γ1)) (Biolamina, UK) and human plasma FN (Chemicon, UK) were diluted in PBS containing Ca2+ and Mg2+ (PBS+) (Invitrogen, UK), and rat tail Col I and Col IV (BD Biosciences, UK) were diluted in 1 % (v/v) acetic acid to the required concentrations recommended by the manufacturer’s instructions. Tissue culture plates (Corning, UK) were pre-coated with 0.1 % (w/v) bovine serum albumin (BSA) in PBS+ (control wells) or with ECM molecules (100 nM) for 1 h at room temperature, or at 4 °C overnight. Non-specific cell-binding sites were then blocked with filter sterilised (0.22 μm pore size filter, Nalgene, UK) 0.1 % (w/v) BSA in PBS without Ca2+ or Mg2+ (PBS−) at room temperature for 1 h, and plates were washed in PBS− three times before cell seeding.
Cell cultures
Primary rat brain endothelial cell (rBEC) cultures were prepared from 6–8 Sprague-Dawley adult rat brains, as described previously [
8]. Cells were grown in tissue culture flasks (T25 Corning, UK) in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, UK) supplemented with 20 % (v/v) plasma-derived serum (PDS, First Link Ltd, UK), 2 mM glutamine, 80 μg/ml heparin, 0.5 μg/ml basic fibroblast growth factor, 1 % (v/v) rBEC supplement (to a final concentration of 5 μg/ml ascorbic acid, 5 μg/ml insulin, 5 μg/ml transferrin, 5 ng/ml sodium selenite and 325 μg/ml glutathione), 100 units/ml penicillin and 0.1 μg/ml streptomycin, in a 5 % CO
2 humidified incubator at 37 °C until cultures reached confluency (10–12 days in vitro, DIV). The purity of the cultures was at least 99 %, as assessed by Von Willebrand factor immunostaining (data not shown).
Primary rat astrocyte cultures were prepared from 1–3-day-old Sprague-Dawley rat pups as described previously [
11,
12]. Cells were plated in the lower chamber of Transwell® inserts pre-coated with poly-D-lysine (Sigma, UK) at a density of 10,000 cells/cm
2 and were grown in DMEM supplemented with 10 % (v/v) heat inactivated foetal bovine serum (FBS, Lonza Sales AG), 100 units/ml penicillin, and 0.1 μg/ml streptomycin, in a 5 % CO
2 humidified incubator at 37 °C. Cells were grown for 3 to 4 days before being co-cultured with rBEC cultures. The purity of the cultures was 98 %, as assessed by glial fibrillary acidic protein (GFAP) immunostaining (data not shown).
Generation of the rat in vitro BBB model
Medium from primary rat astrocytes grown in the lower chamber of Transwell® plates were completely removed and replaced with rBEC growth medium. Transwell® inserts (0.4 μm pore size polyester membrane) were then inserted into the appropriate wells and rBECs; obtained by trypsinisation of confluent rBEC, cultures grown in T25 flasks were seeded at a density of 75,000 cells/cm2 onto ECM-coated Transwell® inserts. The rat BBB model was maintained in a 5 % CO2 humidified incubator at 37 °C. The medium was changed 24 h post seeding and every 2 days until confluency (4–5 DIV).
Cell adhesion assays
Cell adhesion to the ECM was assessed using cell attachment and cell spreading assays as previously reported [
8].
Oxygen-glucose deprivation and interleukin-1β treatment
In order to mimic the ischaemic and inflammatory conditions that occur during stroke, the in vitro BBB model was exposed to oxygen-glucose deprivation (OGD) with or without reoxygenation, and in the absence or the presence of IL-1β, as follows. To produce OGD conditions, rBEC-astrocyte co-cultures were placed in an airtight hypoxic glove box. Nitrogen gas was used to purge other gases from the hypoxic glove box, which was then placed in an airtight chamber at 37 °C with CO2 and O2 levels set at 5 and 1 %, respectively. The original glucose-containing rBEC growth medium was removed, and wells were washed once with glucose-free DMEM before addition of glucose-free DMEM medium to each well. Cultures were exposed to OGD for 2.5 h. The OGD condition was terminated by removing the cultures from the hypoxic chamber and changing the culture medium to glucose-containing medium (1 g/l) supplemented with PDS (20 % v/v) for different times of reoxygenation. Control cultures were maintained in normoxic conditions in DMEM-containing glucose for 2.5 h. For induction of inflammation, recombinant rat IL-1β (R&D Systems, UK), dissolved in vehicle composed of 0.1 % (w/v) low endotoxin BSA in 0.9 % (w/v) sodium chloride, was added to the upper Transwell® compartment for different amounts of time at a final concentration of 10 ng/ml, and at the start of reoxygenation for a period of 2 h for the OGD experiments.
Immunocytochemistry
The polyester membranes of Transwell® inserts were cut out of the insert cases with a scalpel. Cells were then rinsed three times with PBS, permeabilised with 0.1 % (v/v) Triton® X-100 and 1.5 mM sodium azide in PBS for 10 min, rinsed with PBS, and incubated with 0.25 % (w/v) NH
4Cl in PBS for 5 min. Cells were incubated with 1 % (v/v) donkey serum for 1 h in order to block all non-specific binding sites and were subsequently incubated with primary antibodies; rabbit anti-human ZO-1, or mouse anti-human occludin antibodies (Invitrogen, UK) at a final concentration of 0.25 μg/ml. Cells were then incubated for 1 h with Alexa Fluor® 594-conjugated donkey anti-mouse IgG antibody (Invitrogen, UK) or Alexa Fluor® 488-conjugated donkey anti-rabbit IgG antibody (Invitrogen, UK) at a working dilution of 1:1000. Images were acquired on a Delta Vision RT (Applied Precision, UK) restoration microscope using a
60× 1.42 Plan Apo objective or using an Olympus BX51 upright microscope equipped with 4×/0.13 Plan fln, 10×/0.3 Plan fln and 20×/0.5 Plan fln objectives. The images were collected using a Coolsnap HQ camera (Photometrics, UK) with a Z optical spacing of 0.2 μm and processed using ImageJ software 1.37v (National Institutes of Health, USA). The mean intensity and the ratio of the mean cytoplasmic intensity to the mean membranous intensity were quantified optically using ImageJ. Circularity of cells was calculated automatically by the ImageJ software using the formula
$$ \mathrm{Circularity} = 4 \times \left(\mathrm{area}/{\mathrm{perimeter}}^2\right). $$
A circularity value of 1.0 indicated a perfect circle whereas a value of 0.0 indicated an elongated shape.
Measurement of trans-endothelial electrical resistance (TEER)
An EVOM™ Epithelial Voltohmmeter and chopstick electrodes (World Precision Instruments, UK) were used for the measurement of the electrical resistance of brain endothelial cell monolayers grown on Transwell® inserts. Monolayer TEER was calculated by subtracting the value of a blank Transwell® insert from the total resistance obtained for the endothelial monolayer and insert, and each TEER value was normalised for the surface area of the insert.
Reverse-transcriptase polymerase chain reaction (RT-PCR)
Total RNA was isolated from rBECs using the ISOLATE RNA mini kit (Bioline, UK) according to the manufacturer’s instruction, and the concentration and purity of RNAs were determined by measuring the absorbance at 260 nm and the 260/280 nm ratio, respectively, by Nanodrop (Thermo Scientific, UK). mRNAs were reverse transcribed to cDNA using the cDNA synthesis kit (Bioline, UK). cDNAs (1 μl) were then amplified in a GeneAmp® PCR system 9700 in the presence of 5 μl Mytaq red mix (Bioline, UK), 200 nM forward primer, 200 nM reverse primer (Eurofins MWG operon, primer sequences are found in Table
1), and RNase-free water (to a total volume of 50 μl). PCR reactions were then conducted for
lmα4,
lmα5,
lmβ1,
lmγ1
,
col4,
fn, and the housekeeping gene
Rpl13a (ribosomal protein L13A) as follows: 1 min at 95 °C [15 s at 95 °C, 15 s at annealing temperature (53 °C), 10 s at 72 °C] for 18–38 cycles, and a 5-min final extension period at 72 °C. The cycle number for each reaction was chosen to be in the linear phase of amplification. PCR products were separated by electrophoresis using an ethidium bromide-containing 1.5 % (w/v) agarose gel and were quantified using GE healthcare ImageQuant™. Control PCR reactions for each pair of primers used total RNA to ensure that PCR products were not due to genomic DNA amplification.
Table 1
Primer sequences for RT-PCR
Lmα4 | Forward | AGAATGTTCGCCCTGTGACT | 437 |
Reverse | CCAGGAGCACATCTTTCACA |
Lmα5 | Forward | GACTCGCCTCATGTCTGTCA | 424 |
Reverse | TGCACTGGCCTGACTCTG |
Lmβ1 | Forward | TCCTGACAGCCATCTCATTG | 371 |
Reverse | AAGCAGGATCTAAGGCACGA |
Lmγ1 | Forward | GCAGCCTTCTTGACCGACTA | 379 |
Reverse | GCCTTCCTTCCAGAGTTGAA |
FN | Forward | CACATGGAGCAAGAAGGACA | 257 |
Reverse | AGGTGAACGGGAGAACACAG |
Col IV | Forward | AAAGGAGAGCGAGGCTACC | 349 |
Reverse | GTCCAACTTCGCCTGTCAA |
Rpl13A | Forward | GAGGGCATCAACATTTCTGG | 428 |
Reverse | GCCTGTTTCCTTAGCCTCAA |
Statistical analysis
Data were analysed using GraphPad Prism. Data were analysed by one sample repeated t test, one-way analysis of variance (ANOVA) with the Tukey post hoc test or by two-way ANOVA with the Bonferroni post hoc test. The level of significance was represented as *p < 0.05, **p < 0.01, and ***p < 0.001.
Discussion
The BBB undergoes dynamic physical and functional changes after cerebral ischaemia, including degradation of key ECM molecules of the basement membrane, and loss of physical interactions between the basement membrane, endothelial cells, and perivascular astrocytic endfeet. These events lead to increased BBB permeability and are the primary events allowing leucocyte infiltration which is known to contribute to damage (see [
15] for review). These events occur alongside the development of a potent vascular inflammatory response primarily initiated by IL-1 acting on endothelial cells [
10]. Although our previous study has identified a dynamic process of vascular ECM remodelling after ischaemic injury [
8], the precise mechanisms and functional consequences of those changes have largely remained unexplored. Using an in vitro model of the BBB, we showed here for the first time that hypoxia and IL-1 are key triggers for BBB dysfunction, that this process is accompanied by increased expression of key brain vascular ECM molecules, and that LM10 is a key ECM molecule implicated in BBB repair after inflammatory injury.
We first demonstrated that, although OGD and IL-1 treatment caused no significant changes in expression levels of occludin and ZO-1, both OGD reoxygenation and IL-1 induced marked changes in their cellular localisation, with translocation from the plasma membrane to the cytosolic compartment, resulting in decreased levels at the tight junction. This was accompanied with a marked change in cellular morphology as well as significant decreases in BBB permeability. The effect of hypoxia [
16,
17] and IL-1 [
18] on increasing BBB permeability in vitro has been previously reported and is consistent with BBB dysfunction seen in ischaemic and inflammatory conditions such as stroke [
19]. However, our study is the first to show that cellular relocalisation of key tight junction proteins could be the primary mechanism of BBB disruption. Furthermore, the change in cellular morphology indicated cell swelling, which is in agreement with changes seen in vivo where vasogenic oedema characterised by endothelial cell swelling occurs after cerebral ischaemia [
17]. In our study, we have used occludin and ZO-1 expression/cellular localisation as established markers of BBB integrity. However, one cannot exclude the possibility that other tight junction molecules are also affected. Amongst those, claudin-5 is another key tight junction molecule, and two very recent studies using similar in vitro approaches to ours found decreased claudin-5 expression concomitant with decreased occludin expression after OGD and reoxygenation [
20,
21].
We further showed that the expression of key ECM molecules known to be associated with the cerebrovasculature, namely FN (
fn), Col IV (
col4), LM8 (
lmα4,
lmβ1,
lmγ1), and LM10 (
lmα5,
lmβ1,
lmγ1), was strongly increased in endothelial cells exposed to OGD; increased expression was transient since expression of all ECM molecules tested returned to basal level after 2 h of reoxygenation. These results are in agreement with previous studies showing that expression of FN, Col IV, and LM isoforms is increased after hypoxic conditions in vitro in endothelial cells [
3] and in vivo [
8,
22]. However, our findings further identified LM8 and LM10 to be markedly induced by hypoxia, which has not been reported previously. Importantly, we found that IL-1 is a key inducer of endothelial cell ECM expression in vitro, since expression of
col4,
fn,
lmα4,
lmα45, and
lmyγ1 was strongly increased by IL-1 treatment, whilst
lmβ1 expression was slightly reduced. The contribution of IL-1 to endothelial cell activation has been extensively reported previously [
10,
23], but our study is the first to demonstrate that IL-1 also upregulates endothelial cell expression of ECM molecules, and suggests that both ischaemia and subsequent inflammation can promote ECM expression in the cerebrovasculature after stroke. This is in agreement with other studies showing increased ECM expression in the brain vasculature after stroke [
3,
24], which has been proposed as a key step for ECM remodelling and BBB recovery.
In an attempt to understand the pathophysiological consequences of increased expression of ECM molecules after hypoxia and inflammation in endothelial cells, we have tested the effect of the same recombinant ECM proteins on endothelial cell adhesion and markers of BBB dysfunction induced by IL-1. We found strong adhesion of cerebrovascular endothelial cells to Col I, Col IV, FN, and LM10, but not to LM8. Interestingly, we found that the TEER of the endothelial cell monolayer strongly increased over the time of culture when cells where plated onto Col I, Col IV, or FN, and that this increase was further potentiated when cells were plated onto LM10, suggesting that this ECM molecule has a very important role for the establishment of BBB integrity. In support of this, we also found that LM10 specifically reversed key features of BBB dysfunction in vitro, including occludin cellular relocalisation and cell swelling. The role of LM10 in peripheral immune cell transmigration has been demonstrated previously [
13], and our study is the first to demonstrate that LM10 could play an important role in BBB recovery and repair. The effect of LM10 on IL-1-induced BBB dysfunction was, however, only partial since LM10 failed to affect IL-1-induced decreased TEER in vitro. The reason for this is unclear, but one likely possibility is that whilst LM10 may reverse key microstructural changes at the tight junction, some possibly undetected nanostructural changes that could affect the TEER might not be initiated by plating the cells on LM10 only. This may indicate that although LM10 appears to trigger partial recovery of BBB dysfunction induced by IL-1 in vitro, other key ECM molecules are probably required to promote full BBB recovery after injury in vivo. Taken together, our results suggest that ECM remodelling, through over-expression of key ECM molecules at the cerebrovasculature, may be a critical step for the restoration of BBB integrity after injury. Recent in vivo studies found that increased expression of ECM molecules (including LM isoforms) correlates with restoration of BBB functions [
25‐
27], and the in vivo relevance of our finding, particularly in relation with the contribution of LM10 to BBB repair, remains to be determined.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
EP and JP supervised the project. KK performed the experimental work. EP, JP, and KK wrote the paper. All authors read and approved the final manuscript.