Reduced Tau protein expression is associated with frontotemporal degeneration with progranulin mutation

Frontal grey matter necropsic tissues (around 100 mg) were homogenized in UTS buffer (Urea 8 M, Thiourea 2 M, SDS 2 %) using a tissue grinder Potter-Elvehjem with a PTFE Pestle. The homogenate was further sonicated on ice and spun at 7500 × g during 10 min to remove tissue debris. The supernatant was kept at −80 °C until use. Protein amount was determined by Bradford protein assay, subsequently diluted in NuPAGE® lithium dodecyl sulfate (LDS) 4× sample buffer (glycerol 40 %, LDS 4 %, Ficoll 400 4 %, Triethanolamine chloride 800 mM, phenol red 0.025 % and Coomassie G250 0.025 %, EDTA disodium 2 mM, pH 7.6) supplemented with NuPAGE® sample reducing agents (Invitrogen) and loaded onto 4–12 % NuPAGE® Bis-Tris Novex Gels. Proteins were transferred on nitrocellulose membrane of 0.45 μM porosity (GE Lifesciences) using liquid transfer XCell II™ Blot Module, according to the manufacturer’s instructions (Invitrogen). After saturation for 30 min at room temperature with TNT (Tris 15 mM, pH 8, NaCl 140 mM, Tween 0.05 %) added with 5 % skimmed milk powder or 5 % BSA, membranes were rinsed three times 10 min with TNT and thereafter incubated with primary and secondary horseradish peroxidase-coupled antibodies. All primary antibodies and dilutions are listed in Table 1. The peroxidase activity was revealed using a chemiluminescence kit (ECL, GE Lifesciences) and an ImageQuant™ LAS4000 biomolecular imaging system (GE Lifesciences), according to the manufacturer’s instructions. Quantifications were performed using ImageJ 1.46 software (NIH Software).

Frozen UTS brain samples (a total of 1.5 mg of protein for each condition) was unfrozen on ice and proteins were precipitated using chloroform/methanol precipitation [25]. The protein-dried pellet was resuspended in UTC buffer (Urea 8 M, Thiourea 2 M supplemented with 4 % CHAPS) and kept at −80 °C until use. Protein concentration was measured using Quick-Start Bradford Dye Reagent (Bio-Rad) and sample quality was evaluated by loading 15 μg of proteins onto 4–12 % NuPAGE® Bis-Tris Novex Gels and stained with Coomassie R-250 (Biorad).

The 2D-DIGE was performed as previously described [25]. Briefly, 50 μg of protein was covalently coupled with 400 pmol of cyanine dyes diluted in dimethylformamide, according to the manufacturer’s instructions (CyDIGE, GE Lifesciences). Each sample was labeled with either Cy3 or Cy5 fluorescent dyes (GE Lifesciences) and kept for 1 h at 4 °C in darkness. Cross-labeling with either Cy3 or Cy5 dyes was performed in order to avoid a preferential coupling of one cyanine to a sample. A pool of both samples containing equal amount of protein (50 μg in total) was labeled with Cy2 fluorescent dye and used as internal standard in accordance with the manufacturer’s instructions (GE Lifesciences). Finally, the internal standard labeled with Cy2 and the samples labeled with either Cy3 or Cy5 were pooled and the final volume was adjusted to 350 μL by the addition of rehydration buffer [Urea 8 M, Thiourea 2 M, CHAPS 2 %, Destreak reagent 1.1 % (GE Lifesciences), IPG buffer pH 3–11 1.2 % (GE Lifesciences), bromophenol blue 0.01 %]. Samples were prepared in quadruplicate and loaded onto four independent IPG strips. Eighteen cm long linear pH gradient of 3–11 IPG strips (GE Lifesciences) were rehydrated overnight with the samples in a rehydration cassette recovered with mineral oil. Excess or mineral oil was discarded and isoelectrofocalisation was achieved using IPGphor isoelectric focusing apparatus (GE Lifesciences). A seven steps procedure was applied with the following conditions: 150 V for 1 h, 200 V for 5 h, 200 V to 500 V step gradient for 2 h, 500 to 1000 V step gradient for 2 h, 1000 V to 4000 V gradient for 2 h, and finally 8000 V gradient for 2 h. Current was limited to 50 μA per strip. Strips were then equilibrated in equilibration buffer (Urea 6 M, SDS 2 %, Glycerol 30 %, Tris–HCl 50 mM, pH 8.6) with successively 1 % DTT (dithiothreitol) and 4.7 % iodoacetamide for 15 min. Proteins were then separated in the second dimension on 1 mm-thick 12 % SDS-PAGE gels in an ETTAN DALTSix system (GE Lifesciences). Gels were run at 2.5 W per gel overnight. Fluorescently labeled protein spots were visualized using a Typhon FLA 9500 imager (GE Lifesciences). Gels were scanned at 200 μm resolution and images were exported for further analysis using SameSpots (TotalLab) software.

In order to identify proteins of interest, two preparative 2D-gels with respectively 500 μg of brain protein of each condition were performed. After electrophoresis, gels were fixed in ethanol 30 %, orthophosphoric acid (OPA) 2 % overnight. Following washing in OPA 2 %, gels were incubated 30 min in pre-coloration buffer (ethanol 18 %, OPA 2 % and ammonium sulfate 0.9 M) before Coomassie blue staining (Brillant Blue G-250, Bio-Rad) for 48 h.

Spot labelling shown to be significantly different between two conditions after SameSpots analyses was manually excised from preparative gels. Each separate spot was incubated in DTT 10 mM and alkylated (iodoacetamide 55 mM) before trypsin digestion (Promega) overnight at 37 °C, according to the manufacturer’s instructions. Supernatants, containing digested peptides, were dried using centrifuge vacuum (Concentrator 5301, Eppendorf) and resuspended in ultra-pure water supplemented with trifluoroacetic acid (TFA) 0,1 %. The resulting peptide mixture was spotted onto a MALDI plate with freshly dissolved α-cyano-4-hydroxycinnaminic acid (10 mg/ml in acetonitrile 50 %, TFA 0.1 %). Mass spectrometry was achieved with a MALDI-TOF-TOF Autoflex Speed (Bruker Daltonics). MS and MS/MS data were analyzed with BioTools software and peptides sequences were analyzed with Mascot (http://​www.​matrixscience.​com/​). A mascot score above 61 was considered significant for protein identification.

Total RNA was extracted from the tissue of the frontal cortex and purified using the RNeasy Lipid Tissue Mini Kit (Qiagen) following the manufacturer’s instructions. For each RNA sample, integrity (RIN, RNA Integrity Number) was assessed on 2100 bioanalyzer (Agilent Technologies, Waldbronn, Germany) using the RNA 6000 nano kit according to the manufacturer protocol.

One microgram of total RNA was reverse-transcribed using Applied Biosystems High Capactiy cDNA reverse transcription kit. RT-qPCR analysis was performed using an Applied Biosystems Prism 7900 SYBR Green PCR Master Mix. The amplification conditions were as follows: initial step of 10 min at 95 °C, followed by 45 cycles of a 2-step PCR consisting of a 95 °C denaturing step for 15 s followed by a 60 °C extension step for 25 s. Primers used were: Tau 5’UTR 5’ACAGCCACCTTCTCCTCCTC3’ and 5’ GATCTTCCATCACTTCGAACTCC3’; Tau E11-12 5’ACCAGTTGACCTGAGCAAGG3’ and 5’ AGGGACGTGGGTGATATTGT3’ and RPLP0 5’GCAATGTTGCCAGTGTCTG3’ and 5’ GCCTTGACCTTTTCAGCAA3’. Amplifications were carried out in triplicate and the relative expression of target genes was determined by the ΔΔC_T method [26].

For western blot and RT-qPCR statistical analyses, the non-parametric Mann–Whitney test or the Kruskall-Wallis test were performed. All statistical analyses were performed using the GraphPad Prism 6 program (GraphPad Software) and statistical significance was set at * p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Neuropathological assessment of all cases was performed in the departments of anatomo-pathology of CHU-Lille and Hôpital Pitié-Salpêtrière. Detailed information on pathology and demographic data are summarized in Table 2.

Tau protein expression was studied in all cases. We first checked by western-blotting, if there was any Tau pathology in these brains, since it has been described in AD, and a subset of FTLD-TDP patients [27, 28]. Lack of phospho-Tau immunoreactivity was a condition to exclude Tau pathology and therefore any FTLD-Tau as compared with FTLD-MAPT and AD (data not shown). Thereafter, Tau expression was investigated by using antibodies targeting Tau protein independently of its phosphorylation state to evaluate total Tau protein level. These well-characterized antibodies either target the amino-terminal (Tau N-ter), the median (Tau 5) or carboxy-terminal epitope of Tau (Tau C-ter). In adult human brain, six Tau isoforms are expressed from MAPT gene through alternative mRNA splicing [28]. These six Tau isoforms give rise to a unique biochemical signature made of three bands (Fig. 1a, Control patients 1 to 3). Thus, western blot analysis highlighted significant decrease of all six Tau isoforms in eight FTLD-TDP brains compared to control, AD and other FTLD brains (patients 22 to 29, Fig. 1a). Interestingly, this decrease is observed with all three Tau antibodies suggesting that Tau holoprotein isoform expression is impaired (Fig. 1a, compare patient 25 with patient 33). More interestingly, this reduction of Tau protein expression is restricted to FTLD-TDP brains associated with mutations on the GRN gene (Fig. 1a and b) and not associated with other FTLD-related gene mutations. Indeed, Tau protein expression in FTLD-TDP-C9ORF72, sporadic FTLD-TDP or FTLD-FUS patients is rather homogeneous from one patient to another with each antibody (Fig. 1a). Consequently to these results, GRN cases with reduced Tau protein levels were designated as FTLD-TDP-GRNlτ and other FTLD-TDP cases with conserved Tau protein expression as FTLD-TDPτ.

This reduced Tau protein level could result from a lower transcription of MAPT gene in these brains. However, RT-qPCR using primers targeting constitutively Tau mRNA encoded sequences [5’ UTR and exons 11–12 (E11-12)] revealed no significant decrease in total Tau mRNA level whatever the neuropathological group considered (Additional file 1: Figure S1). Therefore, consistent with previous data published in 2001 [21], these data confirm a reduction in Tau protein expression that cannot be explained by a MAPT gene trancription modification. But more interestingly, herein we show that this decrease in Tau protein expression is restricted to patients with GRN mutations.

Since Tau protein level is reduced but not mRNA, we investigated if other proteins could be modified. We therefore performed a quantitative proteomic analysis using 2D-DIGE to evaluate any dysregulation of other protein expression. For this purpose, proteomes of FTLD-TDPτ brains (n = 3, cases 14, 15 and 16) and FTLD-TDP-GRNlτ (n = 3, cases 22, 24 and 25) were compared. Following bioinformatics assisted analysis of 2D-DIGE gels (n = 4), 26 protein spots with significant differential level of expression between FTLD-TDP-GRNlτ and FTLD-TDPτ brains were isolated for further identification (Fig. 2a, b; Table 3). According to the mass spectrometry analysis, 20 distinct proteins including 6 isovariants of the same protein were identified. Among the 20 proteins identified with a significant mascot score (>61), the amount of seven proteins decreased while that of 13 increased in FTLD-TDP-GRNlτ (Table 3). Eleven proteins which intensity varies belong to proteins involved in metabolism (Table 3). Stress-related protein HSP-70.1 and structural proteins such as Gelsolin and Neurofilament light chain showed an increased expression (Table 3). A decrease of UCHL1 (spot 976, −1.3 fold change), a neuronal enzyme involved in ubiquitinated proteins processing, was also found (Table 3). Interestingly, decrease and modification in proteins involved in synaptic function (STXB1, DPYL2 and GLNA gene product in spot 448, 481, 689 with −1.3, −1.3 and −1.2 fold change, respectively) were observed suggesting a stronger synaptic impairment in the FTLD-TDP-GRNlτ group (Table 3). Regarding glial cells, a decrease in glutamine synthetase (GS; astrocytic enzyme involved in glutamate metabolism) was observed with a −1.2 fold change, whereas the highest fold change (+3.2) was related to four spots corresponding to GFAP (Table 3). Taken together, these data demonstrate a strong correlation between reduction of Tau protein expression, astrocytic and synaptic dysfunctions. Therefore, these proteomic data highlight quantitative dysregulation of protein expression other than Tau proteins in the brain from patients with FTLD-TDP bearing GRN mutations.

To validate these proteomic results found in a subset of patients, we therefore undertook an analysis of dysregulated neuronal and astrocytic proteins in all brain samples (FTLD-TDP-GRNlτ, FTLD-TDPτ and control) using western blot analysis. We first confirmed an increase in HSP-70 protein level in FTLD-TDP-GRNlτ cases (Fig. 3a, b). Very strikingly, we observed as in 2D-DIGE, an upsurge in GFAP expression in FTLD-TDP-GRNlτ group in comparison with both control and other FTLD-TDP cases (Fig. 3a, b). Noteworthy, GS was found to be dramatically decreased (Fig. 3a, b). With regards to synaptic proteins, several synaptic markers were decreased including α-synuclein and PSD-95 (Fig. 3a, b). These dysregulations found in FTLD-TDP-GRNlτ brains could be the reflect of a global proteome deterioration in these samples. We thus tested the level of several proteins such as Neuronal Specific Enolase (NSE), Aconitase, Histone H3 and Neurofilaments. Their levels remain unchanged among the different FTLD subclasses (Additional file 2: Figure S2). Finally, it is also worth noting that among FTLD patients we could not find any correlation between Tau protein decrease, macroscopic atrophy, post-mortem delay (PMD) and RNA Integrity Number (RIN) (Table 2, Additional file 3: Figure S3a, b, c respectively). All these results provide further evidence that specific dysregulations affect FTLD-TDP-GRNlτ patients such as dramatic synaptic impairment and massive reactive astrogliosis.