Background
Gastric cancer is one of the most common malignant tumors and is the third leading cause of cancer mortality worldwide [
1]. Chronic inflammation is correlated with many malignant tumors [
2,
3], and chronic atrophic gastritis with intestinal metaplasia is associated with an increased incidence of gastric cancer compared with the normal population [
4].
Helicobacter pylori (HP) is considered a primary carcinogen in gastric cancer pathogenesis by the WHO. Consequently, chronic inflammation induced by
HP plays an important role in gastric cancer occurrence and development [
3,
5‐
8]. Lipopolysaccharide (LPS) is a toxic component of the outermost layer of the
HP cytoderm and may contribute to long-term inflammatory injury in the gastric mucosa [
9,
10].
Transmembrane Toll-like receptors (TLRs) are a class of signal transduction proteins referred to as pattern recognition receptors that can specifically recognize pathogen-related molecular patterns (PAMPs). TLR4 was first discovered as a human TLR that is sensitized by LPS from Gram-negative bacteria [
11,
12]. Related research found that TLR4 is upregulated in gastric cancer tissues and has low expression in normal gastric mucosa [
13,
14]. LPS can induce the formation of an LPS-TLR4-MD-2 multimer by complexing with TLR4 and myeloid differential protein-2 (MD-2), which can further activate proinflammatory signaling pathways and facilitate the expression of corresponding cytokines and receptors [
15,
16]. Consequently, the pathogenic mechanism of TLR4 in gastric cancer progression should be studied. CXC chemokine receptor 7 (CXCR7), a second receptor for CXCL12, has been detected on the surface of multiple types of tumor tissues [
17,
18]. Nevertheless, the biological function and regulation of CXCR7 and its relationship with TLR4 and MD-2 in gastric cancer are still not completely understood and are therefore worthy of study.
In the present study, we explored the function of CXCR7 in the LPS/TLR4/MD-2 regulatory pathway in gastric cancer. LPS exposure increased the expression of CXCR7 in gastric cancer SGC7901 cells, which highly express TLR4/MD-2. Moreover, LPS stimulation induced CXCR7 expression in gastric cancer via TLR4/MD-2 signaling to promote the proliferation and migration of SGC7901 cells. Furthermore, tumor-bearing nude mice and clinicopathology were used to verify that the LPS/TLR4/CXCR7 pathway may be critical during gastric cancer development. These results suggest that the connection between inflammation and gastric cancer may enable the development of novel methods for inhibiting tumor occurrence and development.
Methods
Tissue specimens
From 2012 to 2016, tissues from one hundred fifty gastric cancer patients (all gastric adenocarcinoma) were obtained from the Department of Pathology, The First Affiliated Hospital of Bengbu Medical College. Paracancerous normal tissues from sixty patients were used as controls. Histopathologic examination was performed by two pathologists to verify the histological diagnosis. Tumor staging was determined according to the Union for International Cancer Control (UICC) and the American Joint Committee on Cancer (AJCC) gastric cancer TNM staging system (8th edition).
Cell lines and main reagents
The gastric cancer cell lines SGC7901, AGS, MGC-803, MKN-45, BGC823 and GES-1 were purchased from the Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). LPS-EB (LPS from E. coli O111:B4, cat. no. tlrl-eblps) was purchased from InvivoGen, USA. TLR4 monoclonal antibody (clone ab22048) and an MD-2 monoclonal antibody (clone ab24182) were obtained from Abcam, England. CXCR7 monoclonal antibody (clone MAB4227) and CXCL12 antibody (cat. no. 2716-SD-025/CF) were obtained from R&D systems, USA. CXCR7 antagonist (CCX771) was kindly provided by ChemoCentryx. CXCR4 antagonist (AMD3100) was obtained from Adooq Bioscience, USA. HRP-conjugated secondary antibodies for western blotting (cat. no. ab6734) were purchased from Abcam.
Cell cultivation and transfection
AGS cells were cultured in F12 medium (cat. no. 12-615F, Lonza, CH) supplemented with 20% fetal bovine serum (FBS), penicillin (100 U/ml), and streptomycin (100 mg/ml) at 37 °C in 5% CO2. The other cells were grown in RPMI-1640 medium (cat. no. 11875093, Gibco, USA) supplemented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 mg/ml) at 37 °C in 5% CO2.
Specific siRNA sequences against TLR4 (5’-GAGCCGCUGGUGUAUCUUU-3′) and MD-2 (5’-GUGGGAGAGAUUUAAAGCA-3′), as well as a scrambled control siRNA (5’-AGGACTGAGTGTACCGTCT-3′ (Scram)), were designed as shRNAs and inserted into the pGPU6/GFP/Neo vector (GenePharma, Shanghai, China) under the control of a U6 promoter. Cells resistant to G418 (800 μg/mL) were selected and cultivated for further study [
19,
20]. The depletion of endogenous TLR4 or MD-2 by shRNA treatment was determined by RT-PCR and western blotting analyses (performed by GenePharma Biotechnology Company in Shanghai). Cell transfections were performed with Lipofectamine 2000 (cat. no. 11668-027, Invitrogen, USA) based on the manufacturer’s protocol.
Reverse transcription PCR and quantitative real-time PCR
The upstream primers and downstream primers for TLR4, MD-2, CXCR7 and GAPDH are shown in Table
1 [
15]. Total RNA was extracted from cells or tissues with TriPure Isolation Reagent (Roche, cat. no. 11667165001) according to the standard protocol. A NanoDrop® 8000 spectrophotometer (Thermo Scientific) was used to determine the total RNA concentration. cDNA was obtained through reverse transcription of 2 μg of total RNA in a 10 μl reaction. PCR was performed according to the instructions. The expression products were electrophoresed on a 1% agarose gel and photographed. Quantitative real-time RT-PCR (qRT-PCR) was performed with template cDNA using SYBR Premix Ex TaqII (Tli RNaseH Plus; Takara). An ABI PRISM 7900HT sequence detection system was used to detect the mRNA levels of the target genes, which were normalized to the levels of GAPDH.
Table 1
The upstream primers and downstream primers for TLR4, MD-2, CXCR7 and GAPDH
TLR4 | Forward | TGCAATGGATCAAGGACCAGAGG |
Reverse | TGCAGCCAGCAAGAAGCATCAG |
MD-2 | Forward | CCGAGGATCTGATGACGATTA |
Reverse | GGCTCCCAGAAATAGCTTCAA |
CXCR7 | Forward | CACAGCACAGCCAGGAAGG |
Reverse | GTTCCCTGGCTCTGAGTAGTCGA |
GAPDH | Forward | GGATTTGGTCGTATTGGG |
Reverse | GGAAGATGGTGATGGGATT |
Western blot analysis
Gastric cancer SGC7901 cells were lysed in RIPA lysis buffer (USBiological, USA) supplemented with a protease inhibitor cocktail (cat. no. B14001, Biotool, USA). The total protein level in the nuclear lysates was measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). Protein lysates (60 μg) were separated on 10% SDS-PAGE gels. The proteins were transferred to nitrocellulose using an iBlot 2 Dry Blotting System (Thermo Scientific, USA). The membranes were blocked with 5% dry skim milk in PBST at room temperature for 2 h. Blots were probed with mouse monoclonal primary antibodies against MD-2, TLR4 and CXCR7 and then incubated with the appropriate HRP-conjugated secondary antibodies. The membranes were washed, and the immunoreactive bands were observed using a West Pico chemiluminescence system (Pierce). The protein expression level was analyzed compared with the GAPDH level.
Cell proliferation assay
Gastric cancer SGC7901 cells were seeded in 96-well plates (2 × 103 cells per well) in 100 μl of medium containing 1% FBS with or without LPS (500 ng/ml) and cultured for 12, 24 and 48 h. In certain experiments, SGC7901 cells were pretreated (1 h) with CCX771 (1 μM). After 48 h, a CCK-8 assay (Abbkine, USA) was used to assess cell proliferation. Each experiment was sampled in duplicate, and the data are presented as the mean ± SD of three independent experiments.
Cell migration assay
A transwell assay (Chemicon) was performed to assess cell migration. Gastric cancer SGC7901 cells were resuspended in 1% FBS-medium (5 × 105 cells/ml) and seeded into the upper transwell chambers containing 0.5% BSA. Then, 1% FBS-medium without (control) or with CXCL12 (100 ng/ml) was added to the lower chambers. In certain experiments, SGC7901 cells were pretreated (1 h) with CCX771 (1 μM). The experiments were performed at 37 °C and 5% CO2 for 24 h. After incubation, the nonmigrated cells on the upper surface of the filters were removed, and the hematoxylin-stained migrated cells on the lower surface were counted in five fields under a microscope. For quantification, each experiment was performed in triplicate.
Immunohistochemistry (IHC) staining and scoring
All archival paraffin blocks were numbered separately and cut into serial 4-μm-thick sections and subjected to routine deparaffinization and rehydration. Antigen retrieval, inhibition of endogenous peroxidase activity and blocking of nonspecific binding were performed according to the kit instructions. The primary antibodies used were anti-TLR4 (mouse monoclonal antibody, Abcam, US), anti-MD-2 (rabbit polyclonal antibody, Abcam, US) and anti-CXCR7 (rabbit polyclonal, Boster Biological Technology, Wuhan, China). Rat anti-mouse IgG2b-HRP (Catalog No. SBA-1186-05, SouthernBiotech, USA) was used as a second antibody. Positive tissue slices were used as positive controls, and phosphate-buffered saline (PBS) was used instead of a primary antibody as a negative control.
The IHC staining was scored according to the percentage of positive tumor cells and the intensity of the staining. The percentage of positive tumor cells was divided into four grades: 0 (no staining was observed), 1 (< 10% of cells were positively stained), 2 (10–50% of cells were positively stained), and 3 (> 50% of cells were positively stained). The staining intensity was scored as 0 (no staining or faint yellow), 1 (light yellow), 2 (brown), and 3 (dark brown). The final IHC score was obtained by multiplying the staining intensity score by the percentage of positive tumor cells. Scores of 0–2 were negative, and those of 3 to 9 were positive.
Animals and tumor model
Four- to six-week-old athymic nude mice (BALB/C-nu/nu) were purchased from the Shanghai Laboratory Animal Center at the Chinese Academy of Sciences and raised in a specific-pathogen-free facility at Bengbu Medical College. All of the animal procedures were approved by the Animal Welfare & Ethics Committee of Bengbu Medical College. The tumors were xenografted into the left flank of nude mice through subcutaneous injection of 2 × 106 SGC7901 cells in 50 μl of PBS. The mice were intratumorally injected with LPS (400 μg/kg) or the same volume of DMSO every other day. The tumor growth in the different groups was observed every 4 days, and the tumor volume was measured with calipers and calculated using the following formula: larger diameter×(smaller diameter)2/2. When the tumor volume reached approximately 1 cm3, the mice were euthanized. The tumor tissues were removed, and CXCR7 expression was analyzed via IHC.
Statistical analysis
The data were analyzed using the Statistical Package for Social Science software (version 19.0, SPSS Inc., Chicago, IL). The qualitative data for comparisons between groups were assessed with a chi square test and two-sided Fisher’s exact test. All quantitative data are presented as the mean ± SD of three independent experiments. Student’s t-test was applied to assess differences between groups. A P value less than 0.05 was considered statistically significant.
Discussion
Gastric cancer is one of the most common malignant tumors worldwide.
HP infection is involved in gastric carcinogenesis and gastric cancer development. LPS is a lipid and polysaccharide complex that is a unique cell wall component in Gram-negative bacteria [
19].
HP LPS is also the primary endotoxin and has a structure and characteristics similar to those of
Escherichia coli LPS (
E. coli-LPS). Additionally, LPS is the main virulence factor of
HP and is released from damaged cells or bacteria in tumor tissues [
20]. Numerous studies have addressed the key mechanism by which inflammation-induced LPS signaling alters the invasive and metastatic potential of gastric cancer cells. In the present study, we confirmed that LPS can induce and promote SGC7901 cell proliferation and metastasis.
TLR4 activation can promote tumor progression by promoting apoptosis resistance, invasion, metastasis, and immune surveillance evasion. TLR4 is upregulated in many solid tumors, including gastric cancer [
14,
21,
22]. LPS binds to TLR4 in tumor tissues and induces the synthesis of a variety of inflammatory mediators, including TNFa, IL8 and multiple chemokines. Subsequently, an inflammatory microenvironment is generated via MyD88-dependent and independent pathways, promoting tumor development [
23‐
25]. Relevant clinical and experimental studies have shown that CXC chemokines, such as the CXCL12 (SDF-1)/CXCR4 axis, can promote tumor growth, invasion and angiogenesis [
26‐
29]. CXCR7 was originally termed RDC-1 (an orphan receptor). Recently, CXCR7 has been shown to cause chemotaxis in T lymphocytes in response to CXCL12 (the CXCR4 ligand) and was thus identified as a second CXCL12 receptor. Growing evidence suggests that CXCR7 can activate downstream signal transduction molecules, impact cell adhesion and invasion and further promote tumor cell proliferation through a complex signaling cascade [
30‐
33]. Reports on the relationship between CXCR7 and gastric cancer are relatively rare, and the exact mechanism underlying how CXCR7 promotes the occurrence and development of gastric cancer requires further study. In this study, our data elucidated the key mechanisms underlying the promotive effect of inflammation-derived LPS signaling on the metastatic potential of SGC7901 cells. LPS can upregulate CXCR7 expression through TLR4 signaling, thereby promoting gastric cancer cell proliferation and migration. Moreover, higher TLR4 and CXCR7 expression levels were found in gastric cancer tissues than in paracancerous normal tissues. TLR4 knockdown in SGC7901 cells revealed that this receptor is essential for LPS-induced CXCR7 expression. Additionally, we established a nude mouse xenograft model to further assess the function of the LPS/TLR4/CXCR7 pathway in gastric cancer. The results indicated that TLR4 and CXCR7 expression is related to gastric cancer growth and metastatic potential.
MD-2 is a recently discovered secreted glycoprotein. As an important regulator of innate immune recognition processes, MD-2 is a receptor molecule necessary for LPS to activate the TLR4 transmembrane signaling pathway [
34,
35]. Among all of the TLR4 accessory molecules, MD-2 is essential for the response to LPS [
36,
37]. MD-2 mediates the release of proinflammatory cytokines through the formation of TLR4/MD-2 complexes following the recognition of bacterial LPSs. However, the regulatory mechanism and relationship between TLR4-MD-2 and CXCR7 in promoting gastric cancer development remains unknown. In the present study, we aimed to elucidate the connection between TLR4-MD-2 and CXCR7. The results indicated that CXCR7 expression was significantly increased in TLR4/MD-2-positive LPS-stimulated SGC7901 cells. Notably, LPS-mediated CXCR7 expression was blocked by TLR4 or MD-2 knockdown. Moreover, LPS did not affect CXCR7 expression in SGC7901 cells that expressed TLR4 but not MD-2. This result supports the notion that MD-2 is essential to the TLR4 signaling pathway. In addition, the expression level of MD-2 was significantly higher in gastric cancer tissues than in paracancerous control tissues. MD-2 expression was highly correlated with lymph node metastasis and TNM stage. Furthermore, our analysis of gastric cancer tissues from 150 patients showed that CXCR7 expression is positively correlated with that of TLR4 and MD-2 and that these three factors predict a worse prognosis and poorer survival. Nevertheless, more evidence should be obtained to confirm the mechanism underlying TLR4/MD-2 signaling through CXCR7 and the synergistic action of these molecules in tumor development and progression.
Conclusions
In summary, the LPS/TLR4 pathway is linked to gastric cancer development, and the interaction between TLR4, MD-2 and CXCR7 is closely related to tumor growth and metastasis. Understanding the relationship between microbiological signals and gastric cancer could have a major impact on tumor prevention and treatment.
Acknowledgments
We are grateful to Zenong Cheng at the Department of Pathology (Bengbu Medical College) for his assistance with the immunocytochemistry.