Background
Coxsackievirus B3 (CVB3) is a common and important pathogen of viral myocarditis, pancreatitis, and aseptic meningitis in young children and infants. CVB3 infection may lead to acute heart failure and sudden death due to direct cytopathic effects induced by viral replication in the early phase of infection [
1,
2]. Virus elimination from vital organs is considered as a key therapeutic strategy to treat CVB3-associated diseases. However, currently available drugs for the treatment of CVB3 infection are broad-spectrum antiviral drugs with limited efficacy [
3‐
5]. Therefore, understanding of the mechanisms involved in CVB3 infection may provide new clues for developing novel therapeutic strategies against CVB3-induced diseases.
Mitogen-activated protein kinases (MAPKs) are a family of protein kinases involved in converting extracellular stimuli into intracellular responses [
6]. Accumulating evidence has demonstrated that numerous viruses, including CVB3, activate the p38 MAPK subfamily to facilitate inflammatory responses, apoptosis, and viral replication in infected cells [
7‐
11]. The p38 MAPK inhibitor SB203580 suppresses CVB3-induced Hela cell apoptosis and viral progeny release, suggesting that the p38 MAPK signaling is essential for cytopathic effects and life cycle of CVB3 in infected cells [
12]. Pharmacological inhibition of p38 MAPK phosphorylation has been shown to effectively suppress CVB3 replication and release both in vitro and in vivo [
5,
13]. In addition, MAP2K3 is one of the direct upstream activators of p38 MAPK [
14]. At 48 and 72 h post human cytomegalovirus infection, increased activity of MAP2K3 is critical to maintain p38 activation, which is necessary for viral DNA replication [
15]. Therefore, targeting the MAP2K3/p38 MAPK signaling would be a promising therapeutic approach against CVB3 infection.
MicroRNAs (miRNAs) are small noncoding RNA molecules that post-transcriptionally inhibit gene expression by binding to specific sequences within the 3′ untranslated region (3′UTR) of target mRNAs [
16]. Previous reports have demonstrated that many viruses encode miRNAs or exploit host miRNAs to modulate host and/or viral gene expression. For example, Kaposi’s sarcoma-associated herpesvirus can encode 12 miRNA precursors, which generate 25 mature miRNAs. Some of them share seed sequences with host miRNAs, targeting host mRNAs involved in immune responses [
17,
18]. In addition, human immunodeficiency virus type 1 (HIV-1) induces miRNA-29a that specifically targets HIV-1 3′UTR in infected cells to modulate its own life cycle [
19]. Based on miRNA-mediated host-virus interactions, using miRNAs to target mechanisms that promote viral infection and replication is an emerging and promising antiviral strategy. Its feasibility has been demonstrated in several studies, such as miR-130a-mediated suppression of pyruvate kinase in liver and red blood cells inhibits pyruvate production, which is critical for hepatitis B and C virus replication [
20], and the mimics of miR-124, miR-24, and miR-744 that target the p38 MAPK signaling exhibit antiviral effects in both influenza and respiratory syncytial virus infection [
21].
In our previous study, miRNA-21 has been found to be upregulated in heart tissues of mice with CVB3-induced myocarditis [
22]. MiRNA-21 plays an important role in cardiovascular development and is dysregulated in various cardiovascular diseases [
23], such as cardiac hypertrophy [
24], fibrosis [
25], and myocardial infarction [
26]. Interestingly, MAP2K3 is a direct target of miRNA-21 and miRNA-21 mimics can effectively inhibit MAP2K3 expression in hepatocellular carcinoma [
27]. Thus, we hypothesized that miRNA-21 might be involved in the MAP2K3/p38 MAPK signaling during CVB3 infection.
In the present study, we found that miRNA-21 may exert a protective role against CVB3 infection in Hela cells and mouse model through targeting the MAP2K3/P38 MAPK signaling pathway. These findings may enrich our understanding of miRNA-21 function and the underlying mechanism in CVB3-induced diseases, which provides a potential therapeutic approach for the treatment of CVB3 infection.
Materials and methods
Virus and animals
The pCVB3M strain was a generous gift from Decheng Yang at the University of British Columbia, British Columbia, Canada, and was passaged in HeLa cells [
28]. Male BALB/c mice (6 weeks old) were purchased from the Institute of Laboratory Animal Sciences of China (Beijing, China). The animal study was approved by the Review Board of the Capital Institute of Pediatrics (Beijing, China).
miRNA detection
Cellular RNAs were extracted using the miRNeasy MiniKit (Qiagen) according to the manufacturer’s instructions and were then reverse transcribed using a TaqMan MicroRNA Reverse Transcription Kit (Life Technologies). Mature miRNA levels were detected by the TaqMan MicroRNA Assay (Life Technologies) using relative quantitative methods as described previously [
28]. U6 RNA was detected as the endogenous control for data normalization. Reverse transcription primer was 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACA 3′, the sense and anti-sense primers are 5′-ACACTCCAGCTGGCTAGCTTATCAGACTGATG-3′ and 5′-CTCAACTGGTGTCGTGGA-3′. All q-RT-PCR experiments were repeated in triplicates with the no-template as a control.
Luciferase reporter assay
HEK293T cells were seeded in 6-well plates at 5 × 105 per well for 24 h before transfection. Then 5 μl of 20 μM of miR-21 or mutant miR-21 has no human targets were transfected into HEK293T cells simultaneously with 250 ng of wild-type or mutant MAP2K3 3′UTR-pmirGLO plasmid using lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The luciferase activity was measured using a dual-luciferase Reporter Assay System (Promega, Madison) 24 h after transfection and the relative luciferase activity value was achieved against the renilla control.
Virus infection in vitro
HeLa cells were grown in complete medium (DMEM supplemented with 10% newborn calf serum) to 70 to 80% confluence prior to infection. HeLa cells were then infected with CVB3 at a multiplicity of infection (MOI) of 10, unless otherwise indicated, or sham infected with phosphate-buffered saline (PBS) for 1 h in serum-free DMEM. Cells were then washed with PBS and cultured in complete medium for the indicated periods of time.
MAP2K3 inhibition and P38 MAPK inactivation
ON-TARGET plus SMART pool MAP2K3 siRNA containing 4 siRNA against MAP2K3 was purchased from Dharmacon (M-003509-03; Lafayette, CO, USA), and was transfected into HeLa cells using Lipofectamine 2000 at a final concentration of 20 nM according to the manufacturer’s instructions. siRNA unrelated to the human genome was also used as a control. The medium was replaced after 12 h, CVB3 infection were carried out 24 h later at an MOI = 1.
SB203580, P-P38 MAPK inhibitor were purchased from MedChem Express. HeLa cells were treated with 50 μM SB203580 for 30 min and then infected with CVB3 at MOI = 1.
Lentivirus generation and in vitro and in vivo infection
To generate lentiviral vectors overexpressing miRNA-21, oligonucleotides of miRNA-21 forward (5′-GAGGATCCCCGGGTACCGGTTTATCAAATCCTGCCTGAC-3′) and reverse primer (5′-CACACATTCCACAGGCTAGACCAGACAGAAGGACCAG-3′) were synthesized, based on the sequence of human miRNA-21 (5′-uagcuuaucagacugauguuga-3′, MIMAT0000076) from the miRBase database, and the oligonucleotides were introduced into pGCSIL-GFP plasmid (GeneChem Co. Ltd. Shanghai, China). To construct lentivirus, pHelper 1.0 and pHelper 2.0 were purchased from Shanghai GeneChem Co. Ltd. Generation of lentivirus and viral titration evaluation were conducted as described previously [
29]. Lentivirus containing miRNA-21 sequence was designated as Lenti-miRNA-21. Lentivirus containing a miRNA sequence that has no identified target in mammalian cells was also constructed as control and was designated as Lenti-CON.
For HeLa cells, Lenti-miRNA21 was transduced at MOI = 10, CVB3 infection were carried out 72 h later at an MOI = 1.
For susceptible mice, 2 × 108 transduction units Lenti-miRNA-21 were intravenously injected into each mouse via the caudal vein. Mice were then inoculated intraperitoneally with a dose of 1 × 105 plaque forming units (PFU, LD50) of CVB3 virus per mice. Some mice were monitored daily for the onset of paralysis and survival. Other mice were euthanized on days 3, 5 and 7 after infection with CVB3 (n = 10 per group). Experiments were carried out 3 times.
For miRNA-21 expression in the heart of mice, excised mouse heart was weighed and homogenated, total RNA was obtained from homogenated cells with TRIzol reagent and following procedures were as forementioned.
Caspase-3 activity assay
Caspase-3 activity assay was measured according to the manufacturer’s suggestion (R&D Systems). HeLa cells were transduced with Lenti-miRNA-21 at an MOI = 10 followed by CVB3 infection at an MOI = 1 72 h later. 6 and 12 h post infection, cell lysates were harvested and subjected to caspase-3 activity assay by using of a fluorogenic substrate.
Cell viability assays
Cell viability was measured using an MTS assay kit (Promega, Madison) according to the manufacturer’s instructions. HeLa cells were transduced with Lenti-miRNA-21 and infected with CVB3 as above and were then incubated with MTS solution for 2 h at the indicated time point, and the absorbance was measured at 492 nm using a microplate reader. The survival value for the absorbance measured from the control cells was defined as 100%, and the values obtained from the other infected cells were converted to a ratio based on the value of the control sample.
Viral plaque assay and histological analysis in heart tissues
To detected viral titers, supernatants from HeLa cells were collected at 6 h, 12 h and 24 h post infection, and cell debris was discarded by centrifugation for 5 min at 2000 rpm. To detect viral titers within HELA cells, the lysates of infected cells were collected as previously described [
30]. Briefly, cells were trypsinized at 12 h postinfection and counted, followed by PBS rinses and centrifugation at 400×
g for 5 min. Cell pellets were resuspended in 1 ml of DMEM containing 5% fetal calf serum and subjected to three freeze–thaw cycles using liquid nitrogen and a heating block set to 37 °C. Samples were then centrifuged at 10,000×
g for 10 min at 4 °C to remove cell debris. To detect the viral loads of tissues, hearts from mice were weighed, homogenized in 0.5 ml MEM, and centrifuged at 1000 rpm for 10 min. The viral titers in the supernatants, cell lysates, and infected tissues were analyzed by viral plaque assay as previously described [
28], and were expressed as PFU/ml, /5 × 10
5 cells, and/gram, respectively. To assess the severity of myocarditis, paraffin-embedded sections of heart tissues were stained with hematoxylin–eosin and examined histopathologically for evidence of inflammation and necrosis [
28]. To assess apoptosis of cardiomyocyte, Tunel assay and immunohistochemistry staining for cleaved caspase 3 were performed (Tunel Apoptosis assay kit, Beyotime Technology, China, anti-cleaved caspase 3 monoclonal antibody, Cell Signaling Technology, Inc, China) following the manufacture’s instruction or described previously [
29].
Annexin V-FITC/PI staining and flow cytometry
Cells were pooled, pelleted by centrifugation, washed once with ice-cold PBS, and resuspended in binding buffer (10 mM HEPES–NaOH [pH 7.4], 140 mM NaCl, 2.5 mM CaCl2) to a concentration of 106/ml. 0.1 ml of cell suspension was transferred to a 5-ml tube and incubated with 5 μl of Annexin-V and 5 μl of PI for 15 min at 25 °C in the dark. Samples were analyzed by flow cytometry within 1 h on a FACScan flow cytometer (BD Biosciences). Results are presented as the percentage of early apoptotic (Annexin-V+ PI−) and late apoptotic (Annexin-V+ PI+).
Protein detection
Hela cells or homogenated mice heart tissue were collected at the indicated time point and were lysed in RIPA buffer (Kangwei, Beijing, China). Antibodies for detecting MAP2K3, P38 MAPK, P-P38 MAPK, HSP 27, P-HSP 27, cleaved caspase-3, Bax and GAPDH were purchased from Cell Signaling Technology (Cell Signaling Technology, Inc, China). Antibodies for detecting viral VP1 was purchased from Leica Biosystems Newcastle. Western blotting was conducted as described previously [
31].
Statistical analysis
All statistical analyses were performed using the SPSS 13.0 computer software program (SPSS, Inc., Chicago, IL). Survival was analyzed using the log-rank (Mantel–Cox) method. The significance of variability among the experimental groups was determined by the Mann–Whitney U test. All differences were considered statistically significant at p < 0.05.
Discussion
Activation of the MAP2K3/P38 MAPK signaling pathway is essential for CVB3 infection [
5,
12,
13]. Our previous study showed that miRNA-21 that potentially targets MAP2K3 is upregulated in the heart of mice with CVB3-induced myocarditis [
22]. In addition, miRNA-21 has been shown to have beneficial effects on myocardial infarct size in murine models [
26]. However, the association of miRNA-21 with the MAP2K3/P38 MAPK signaling in the context of CVB3 infection remains unclear. In the present study, we found that miRNA-21 may inhibit CVB3 viral progeny release through targeting the MAP2K3/P38 MAPK signaling pathway in vitro. In addition, miRNA-21 pretreatment could reduce viral titer within the heart and improve pathological alterations and clinical outcomes in a mouse model of CVB3 infection. These findings suggest that miRNA-21 may serve as a potential therapeutic agent in the treatment of CVB3-associated diseases.
In this study, we detected dynamic expression of miRNA-21 and the MAP2K3/P38 MAPK signaling in CVB3-infected HeLa cell line which is commonly used in the studies of CVB3 [
31]. When compared with those observed at earlier time points, the miRNA-21 expression in Hela cells was dramatically upregulated at 12 h following CVB3 infection, whereas the protein levels of MAP2K3 and phosphorylated downstream targets, including P-P38 and P-HSP27, were remarkably decreased accordingly, suggesting an association between miRNA-21 and the MAP2K3/P38 MAPK signaling in the context of CVB3 infection. The results of a luciferase reporter assay further confirmed that MAP2K3 is a potential target of miRNA-21, which is consistent with a previous report [
27]. These findings indicate that CVB3 infection can induce miRNA-21 upregulation in host cells, leading to a suppression of the MAP2K3/P38 MAPK signaling.
Following the intracellular replicative process, the virus is released to complete the final stage of the viral life cycle [
32]. Significant reduction in the amount of released virus in response to siMAP2K3 or P38 inhibitor was observed at 12 and 24 h postinfection, suggesting that activation of the MAP2K3/P38 MAPK signaling is indispensable for CVB3 life cycle. Similar results were also observed in infected cells overexpressing miRNA-21 compared with control miRNA first at 7 h post infection and persisted for at least 48 h, accompanied by downregulation of MAP2K3 and dephosphorylation of downstream targets. These findings suggest that miRNA-21 may inhibit CVB3 progeny release via suppression of the MAP2K3/P38 MAPK signaling, which is supported by previous studies [
13,
35]. The inhibition ability of miRNA-21 was comparable to siRNA-MAP2K3 and P38 MAPK specific inhibitor SB203580, and could reach to an extent for more than tenfold, which was improtant in the viral controlling process.
To further investigate whether the inhibitory effect of miRNA-21 on progeny release was due to suppressed CVB3 replication, we detected viral capsid protein VP1 expression as well as the viral load within infected Hela cells [
36,
37]. No significant change in VP1 expression and viral load was observed between infected cells overexpressing miRNA-21 and control miRNA, suggesting that miRNA-21 might not affect CVB3 replication in infected cells at least within 24 h post infection. Because decreased viral progeny release may result from inhibited host cell apoptosis [
33], we speculated that miRNA-21 might protect infected cells from apoptosis. Therefore, we next evaluated the caspase-3 activity and cell proliferation in miRNA-21-overexpressing infected cells. We found that miRNA-21 significantly inhibited the inducive effect of CVB3 on caspase-3 activation and promoted infected cell proliferation in a dose- and time-dependent manner. We also detected apoptosis related cleaved-caspase 3 and Bax expression in miRNA-21-treated infected cells, and apoptosis were also evaluated by Annexin-V/PI staining by flow cytometric, results showed that apoptosis related protein were decreased in the miRNA-21-treated group and apoptosis rate were also declined, suggesting that miRNA-21 might protect host cells from CVB3-induced apoptosis, leading to an improvement in cell survival. A previous study showed that overexpression of antiapoptotic proteins or treatment with a general caspase inhibitor prevents CVB3 virus progeny release at 10 h following infection, indicating that host cell apoptosis facilitates progeny release from infected cells [
33]. Thus, the inhibitory effect of miRNA-21 on host cell apoptosis might contribute to decreased viral release at least during the initial stage of viral infection.
It is well-established that miRNA-21 is closely associated with the pathogenesis of cardiovascular diseases due to its abundance in cardiovascular system and frequent alteration during the development of the diseases [
24‐
26]. However, whether miRNA-21 is favorable or unfavorable to cardiovascular system remains controversial [
24,
26,
38], which may partially due to different mouse strains used in these studies. In the present study, we established a CVB3 infection model using male BALB/c mice and observed significantly reduced CVB3 titer and suppressed MAP2K3/P38 MAPK signaling in the heart tissue of miRNA-21-pretreated mice, which is in agreement with our in vitro data. In addition, the mice pretreated with miRNA-21 exhibited improved pathological alterations, decreased percentage of apoptosis and apoptosis related cleaved-caspase 3 expression in the heart, what is important, miRNA-21 treatment also prolonged survival time. These data suggest that miRNA-21 may be beneficial for the host during CVB3 infection. However, due to insufficient funding support, we did not include a miRNA-21 knockout mouse model in this study to provide more convincing evidence, which needs to be addressed in the future.
In conclusion, in the present study, we revealed a protective role of miRNA-21 against CVB3 infection through targeting the MAP2K3/P38 MAPK signaling pathway both in vitro and in vivo, and viral inhibition were attributed to the inhibition of cell apoptosis process. Our results provides miRNA-21 as a potential therapeutic agent for prevention and treatment of CVB3-induced diseases.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.