Skip to main content
Erschienen in: Journal of Neuroinflammation 1/2017

Open Access 01.12.2017 | Research

Sphingosine 1-phosphate receptor 3 and RhoA signaling mediate inflammatory gene expression in astrocytes

verfasst von: Stephanie S. Dusaban, Jerold Chun, Hugh Rosen, Nicole H. Purcell, Joan Heller Brown

Erschienen in: Journal of Neuroinflammation | Ausgabe 1/2017

Abstract

Background

Sphingosine 1-phosphate (S1P) signals through G protein-coupled receptors to elicit a wide range of cellular responses. In CNS injury and disease, the blood-brain barrier is compromised, causing leakage of S1P from blood into the brain. S1P can also be locally generated through the enzyme sphingosine kinase-1 (Sphk1). Our previous studies demonstrated that S1P activates inflammation in murine astrocytes. The S1P1 receptor subtype has been most associated with CNS disease, particularly multiple sclerosis. S1P3 is most highly expressed and upregulated on astrocytes, however, thus we explored the involvement of this receptor in inflammatory astrocytic responses.

Methods

Astrocytes isolated from wild-type (WT) or S1P3 knockout (KO) mice were treated with S1P3 selective drugs or transfected with short interfering RNA to determine which receptor subtypes mediate S1P-stimulated inflammatory responses. Interleukin-6 (IL-6), and vascular endothelial growth factor A (VEGFa) messenger RNA (mRNA) and cyclooxygenase-2 (COX-2) mRNA and protein were assessed by q-PCR and Western blotting. Activation of RhoA was measured using SRE.L luciferase and RhoA implicated in S1P signaling by knockdown of Gα12/13 proteins or by inhibiting RhoA activation with C3 exoenzyme. Inflammation was simulated by in vitro scratch injury of cultured astrocytes.

Results

S1P3 was highly expressed in astrocytes and further upregulated in response to simulated inflammation. Studies using S1P3 knockdown and S1P3 KO astrocytes demonstrated that S1P3 mediates activation of RhoA and induction of COX-2, IL-6, and VEGFa mRNA, with some contribution from S1P2. S1P induces expression of all of these genes through coupling to the Gα12/13 proteins which activate RhoA. Studies using S1P3 selective agonists/antagonists as well as Fingolimod (FTY720) confirmed that stimulation of S1P3 induces COX-2 expression in astrocytes. Simulated inflammation increased expression of Sphk1 and consequently activated S1P3, demonstrating an autocrine pathway through which S1P is formed and released from astrocytes to regulate COX-2 expression.

Conclusions

S1P3, through its ability to activate RhoA and its upregulation in astrocytes, plays a unique role in inducing inflammatory responses and should be considered as a potentially important therapeutic target for CNS disease progression.
Abkürzungen
BBB
Blood-brain barrier
CNS
Central nervous system
COX-2
Cyclooxygenase 2
EAE
Experimental Autoimmune Encephalomyelitis
GFAP
Glial fibrillary acidic protein
GPCR
G protein-coupled receptor
IL-6
Interleukin 6
KO
Knockout
MS
Multiple Sclerosis
NF-κB
Nuclear factor kappa B
PAR1
Protease activated receptor 1
PTX
pertussis toxin
q-PCR
Quantitative-PCR
S1P
Sphingosine 1-phosphate, S1P1, Sphingosine 1-phosphate receptor 1
S1P2
Sphingosine 1-phosphate receptor 2
S1P3
Sphingosine 1-phosphate receptor 3
S1P4
Sphingosine 1-phosphate receptor 4
S1P5
Sphingosine 1-phosphate receptor 5
Sphk1
Sphingosine kinase-1
VEGFa
Vascular Endothelial Growth Factor A
WT
Wild-type

Background

Sphingosine 1-phosphate (S1P) is a bioactive lipid and G protein-coupled receptor (GPCR) ligand formed within the brain from sphingomyelin and is also present at high levels in blood where it is bound to lipoproteins and stored in erythrocytes [15]. There are five S1P receptor subtypes [6, 7] with S1P1, S1P2, S1P3, and S1P5 (and in some reports S1P4) expressed in the CNS [813]. Astrocytes are activated in response to CNS injury and diseases like multiple sclerosis (MS) and undergo astrogliosis characterized by increases in proliferation, hypertrophy, and glial fibrillary acidic protein (GFAP) expression [1420]. S1P induces astrogliosis when injected into the brain as evidenced by increases in GFAP expression and astrocyte proliferation [2123]. The importance of S1P receptors in disease is highlighted by the widespread acceptance of Fingolimod (FTY720; Gilenya) as a first line oral drug to treat MS [2427]. Phosphorylated fingolimod functions as an S1P analogue that blocks lymphocyte egress through functional inhibition of S1P1 signaling [28, 29]. Its efficacy in the EAE mouse model of MS has also been linked to signaling through S1P1 on astrocytes [30].
The predominant S1P receptor subtype detected by quantitative-PCR (q-PCR) in cortical astrocytes is S1P3, although S1P1 is also expressed on astrocytes from rat and mouse brain [8, 12, 31]. The potential importance of S1P3 signaling in astrocytes is suggested by the finding that this receptor is upregulated in MS lesions and in response to inflammatory stimuli [3234]. In a mouse model of Sandhoff disease characterized by neuronal death and astrocyte proliferation, deletion of S1P3, along with the enzyme sphingosine kinase (Sphk) which catalyzes the synthesis of S1P, decreased astrogliosis and disease severity [35]. Importantly, whereas S1P1 exclusively couples to the G protein Gαi, S1P3 couples promiscuously and its coupling to Gα12/13 activates the small G-protein RhoA [3638]. Previous work from our laboratory documented the importance of RhoA activation in inducing astrocyte proliferation, gene expression, and inflammation in response to stimulation of GPCRs for thrombin and S1P [3944].
Here, we ask whether stimulation of the S1P3 receptor on astrocytes activates RhoA, is responsible for inflammatory gene expression, or can be locally engaged by endogenously formed S1P in an in vitro model of neuroinflammation. We demonstrate that S1P3, and not S1P1, mediates induction of interleukin-6 (IL-6) and vascular endothelial growth factor A (VEGFa) mRNA, and cyclooxygenase-2 (COX-2) mRNA and protein in mouse astrocytes and that this occurs through S1P receptor coupling to Gα12/13 and RhoA. We also demonstrate that simulated inflammation in vitro leads to increases in expression of Sphk1 and S1P3 which could contribute to autocrine inflammatory astrocyte signaling.

Methods

Agonists and inhibitors

Sources were as follows: S1P was obtained from Avanti Polar Lipids. The S1P3 antagonist SPM-354 was synthesized and characterized as described [45]. A cell permeable botulinum C3 toxin exoenzyme, which inhibits RhoA activation, was obtained from cytoskeleton. Pertussis toxin, which ribosylates and inactivates the alpha subunit of the Gi protein, was used to block signaling through receptor coupling to Gi (Tocris Bioscience). The S1P3 specific agonist CYM-51736 was provided by the Rosen laboratory, and the functional S1P1 antagonist and MS therapeutic, FTY720 (Fingolimod), and S1P 2 antagonist JTE-013 was from Cayman Chemicals. S1P was used at 0.5 μM. SPM-354 was used at 5 μM. C3 exoenzyme was used at 0.5 μg/mL. FTY720 was used at 100 nM. CYM-51736 was used at 10 μM, JTE-013 at 1 μM, and pertussis toxin at 100 ng/ml.

Animals

All procedures were performed in accordance with NIH Guide and Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee at the University of California San Diego. C57BL/6 wild-type and homozygous S1P3 KO mice which do not exhibit any gross phenotypic abnormalities [36, 46] were used for astrocyte isolation.

Primary culture of astrocytes

Astrocytes were isolated from P1-P3 postnatal WT and S1P3 KO mice [44]. Purity of astrocytes was determined to be ~95% based on GFAP staining. In all experiments, WT and S1P3 KO astrocytes were used at passage 2. Astrocytes were cultured in six-well plates, maintained in high-glucose DMEM supplemented with 10% FBS/2 mM glutamine/100 units/ml penicillin/100 μg/ml streptomycin (Invitrogen, Carlsbad, CA) at 37 °C in a humidified 5% CO2-incubator. Cells used for experiments were at 80% confluency and serum-starved for 18–24 h prior to agonist treatment.

siRNA transfections

Pre-designed mouse short interfering RNA (siRNA) smartpools for S1P1, S1P2, S1P3, and control siRNA were purchased from Bioneer. Pre-designed mouse siRNA for Gα12, Gα13, Gαq, and sphingosine kinase 1 were purchased from Qiagen, individual siRNAs were tested for knockdown, and the most efficient was selected for use in the current studies. Control siRNA was compared to targeted siRNAs used throughout. WT astrocytes on six-well plates were transfected using DharmaFECT-3 transfection reagent (Thermo Scientific) and 2 μM siRNA in a 1:3 ratio respectively. Reagent and siRNA were incubated alone in OPTI-MEM media (Gibco) at room temperature for 10 min followed by mixing and incubating further for 20 min. The siRNA/DharmaFECT-3 mixture was added to plates containing fresh media. Following overnight incubation, media containing siRNA was removed, and cells were washed. Astrocytes were serum-starved for 18–24 h prior to treatment. The table below lists the predesigned or three smartpool siRNA sequences used in these studies.
siRNA
Sense Sequence
Antisense Sequence
S1P1
GAUAUCAUAGUCCGGCAUU
CCGGAGCUUUGAUUUUGCA
CGGACCUAUUAGCAGGCGU
AAUGCCGGACUAUGAUAUC
UGCAAAAUCAAAGCUCCGG
ACGCCUGCUAAUAGGUCCG
S1P2
CUGUACGUCCGAAUCUACU
CACUUCUGGAGUGCCAGUA
CCUCGGUCUUUAGCCUCCU
AGUAGAUUCGGACGUACAG
UACUGGCACUCCAGAAGUG
AGGAGGCUAAAGACCGAGG
S1P3
UCUUGGUCACCUGUAGCUU
UGUACAGGAUGUAUACGAU
AGACAUCGGGUGCAUCCAA
AAGCUACAGGUGACCAAGA
AUCGUAUACAUCCUGUACA
UUGGAUGCACCCGAUGUCU
12
UGACUUCGUUAUAAAGAAATT
UUUCUUUAUAACGAAGUCATG
13
CCAUAAUCCUCUUCUUAAATT
UUUAAGAAGAGGAUUAUGGAG
q
GGUGGAUAGUAUUAUCCUATT
UAGGAUAAUACUAUCCACCAG
Sphingosine
kinase 1
CGAGCAGGUGACUAAUGAATT
UUCAUUAGUCACCUGCUCGTA

SRE.L luciferase assay

Astrocytes were cultured on 12-well plates and transfected with 500 ng of SRE.L and 50 ng of Renilla as an internal control using DharmaFECT-3 as described above. Following overnight incubation, cells were serum-starved for 18–24 h prior to S1P treatment for 8 h. Cells were lysed, and luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega).

In vitro scratch injury model

WT or S1P3 KO astrocytes were cultured on six-well plates and grown to confluence followed by serum starvation for 18–24 h. To stimulate astrogliosis and inflammation, plates were scratched with a 200-μL pipette tip six times (three vertical and three horizontal) across the dish [47]. Cells were harvested and lysed after 1 h scratch for mRNA analysis or after 8 h for Western blotting as described below.

q-PCR

For gene expression analyses, RNA was extracted from astrocytes using an RNeasy kit (Invitrogen) [40]. Complementary DNA (cDNA) was synthesized with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ABI) and real-time q-PCR performed with TaqMan Universal Master Mix II, with UNG (Applied Biosystems ABI). To analyze gene expression in mouse astrocytes treated with S1P or scratch wounding, gene-specific primers for COX-2, IL-6, VEGFa, S1P1, S1P2, S1P3, Sphk1, and GAPDH (as an internal control) were used (Integrated DNA Technologies). S1P3 KO astrocytes were analyzed for the levels of S1P1 and S1P2 and were found to have no significant compensatory changes (data not shown). Data were normalized to internal GAPDH, and fold change was determined according to a published protocol [48]. Values for comparison for a single gene across multiple samples was determined using cycle threshold (Ct) data fitted to a standard curve. For comparison of multiple transcripts in a single sample, then the 2−ΔΔCt method was applied to the Ct value [48].

Western blotting

Astrocytes were lysed in RIPA buffer (20 mm Tris, 250 mm NaCl, 3 mm EDTA, 3 mm EGTA, and 20 mm β-glycerophosphate) supplemented with sodium vanadate, leupeptin, aprotinin, p-nitrophenyl phosphate, and phenylmethylsulfonyl fluoride. BCA analysis was performed using the Micro BCA Protein Assay Kit (ThermoFisher Scientific) to determine protein concentration. Equal amounts of protein (10 μg) were loaded onto 4–12% 10-well or 15-well SDS-PAGE gels (Invitrogen NuPage System). Gels were transferred to PVDF membranes (Millipore), and the resulting blot was probed with specific antibodies. The COX-2 antibody (Cayman #160126) was used at 1:500 dilution, and the band running at 72 kDa band was quantitated. The GAPDH antibody (Cell Signaling Technology #2118) was used at 1:1000 dilution, and a band at 37 kDa was quantitated. Rabbit secondary antibody was used at 1:4000 dilution. Fold changes were determined by densitometry and normalized to accompanying GAPDH blots.

Statistical analysis

Statistical differences were determined using Tukey’s multicomparison analysis following one-way ANOVA with Prism software (GraphPad). p < 0.05 was considered significant.

Results

S1P3 is highly expressed in astrocytes and mediates increases in COX-2 protein expression

We used q-PCR to compare directly the levels of mRNA expression for S1P1-3 in the cultured mouse astrocytes used in the studies presented here. Relative expression levels for S1P3 (4.7) > S1P1 (1.6) > S1P2 (0.7) mRNA were established using absolute quantitative-PCR (Fig. 1a). To examine S1P receptor subtype involvement in induction of the inflammatory gene COX-2, all three receptor subtypes were knocked down prior to treatment with S1P. Knockdown with S1P1 siRNA (78% decrease in S1P1 mRNA) had no effect on COX-2 protein expression in cells stimulated for 6 h with S1P. Knockdown of S1P3 (80%) significantly attenuated S1P-stimulated COX-2 expression, and the combination of S1P2 and S1P3 knockdown was most effective (Fig. 1b). Knockdown of S1P2 (83%) diminished but did not significantly decrease S1P-induced COX-2 protein expression nor did pretreatment with the selective S1P2 antagonist JTE-013 (Fig. 1c). In contrast, SPM-354, a bitopic antagonist that has a significantly higher affinity for S1P3 than for S1P2 (1840-fold) or S1P1 (30-fold) [45], decreased S1P-induced COX-2 expression by more than 70% (Fig. 1d) further confirming the predominant role of S1P3 activation in COX-2 protein expression. The S1P2 and S1P3 receptor subtypes can serve redundant functions in regulation of RhoA and other downstream responses in some cell systems [36, 49] but our data indicates that S1P3 mRNA is most highly expressed in mouse astrocytes and plays the predominant role in mediating COX-2 protein expression in response to S1P.

S1P3 is required for induction of inflammatory genes in astrocytes

To provide further evidence that S1P3 is the receptor on astrocytes that is primarily responsible for the induction of COX 2 and other inflammatory genes, astrocytes were isolated from WT and S1P3 KO mice. The ability of S1P to increase inflammatory gene mRNA was examined at 1 h treatment since it was demonstrated that mRNA for IL-6 and COX-2 were significantly increased by S1P at this early time [40]. Deletion of S1P3 fully prevented S1P-mediated increases in IL-6 (Fig. 2a) and VEGFa (Fig. 2b) mRNA. Induction of COX-2 mRNA (Fig. 2c) was markedly but not fully attenuated paralleling the changes in COX-2 protein expression shown in Fig. 1b which suggests some redundancy in S1P2 and S1P3 signaling to COX2 expression. Next, we used a recently generated S1P3 receptor allosteric agonist, CYM-51736, which is more specific than the previous S1P3 agonists [50, 51]. CYM-51736 increased COX-2 protein in WT but not in S1P3 KO astrocytes (Fig. 2d), consistent with its specificity and the ability of S1P3 activation to regulate COX-2 mRNA expression. Finally, we tested FTY720 (fingolimod), which acts as an agonist at both S1P1 and S1P3. FTY720 treatment increased COX-2 protein expression in WT but not in S1P3 KO astrocytes (Fig. 2e), suggesting that its agonist actions at S1P3 induce astrocyte inflammatory genes.

S1P3 signals through Gα12/13 and RhoA to induce gene expression

The Gα12/13 proteins are the G-protein family members that most effectively couple GPCRs to RhoA exchange factors and thus to activation of RhoA. To demonstrate that S1P3 activates inflammatory gene expression by signaling through Gα12/13, we used siRNAs to achieve combined knockdown of Gα12 and Gα13 (92% decrease in Gα12 mRNA and 90% decrease in Gα13 mRNA). In addition, RhoA was functionally inhibited by pretreatment of cells with C3 exoenzyme. Both interventions significantly decreased S1P-mediated increases in COX-2 protein (Fig. 3a, b). We further demonstrated that induction of COX-2, IL-6, and VEGFa mRNAs by S1P were attenuated by knockdown of Gα12 and Gα13 (Fig. 3c–e).
The SRE.L luciferase reporter gene contains a truncated TCF-independent binding site for serum response factor (SRF) and is widely used as a readout for activated RhoA, which regulates genes through SRF and its transcriptional co-activator MRTF-A [52, 53]. S1P markedly increased SRE.L luciferase activity (16 to 50-fold, depending on the experiment). The S1P response (shown as 100% in the averaged experiments in Fig. 4) was attenuated by functional blockade of Rho signaling with C3 treatment and by knockdown of S1P2, S1P3, and Gα12/13, but not by knockdown of S1P1 or Gαq. Inhibition of Gαi function by pretreatment with pertussis toxin (PTX) was also without effect on S1P-stimulated SRE.L activation. These data demonstrate S1P3 and S1P2 coupling to Gα12/13 to activate RhoA, which in turn regulates COX-2 and other inflammatory genes in astrocytes.

S1P3 and Sphk1 are upregulated in response to in vitro wounding and mediate COX-2 expression

To determine whether the signaling pathway delineated above could be activated under pathophysiological conditions, we used an in vitro scratch injury model to simulate localized inflammation of cultured astrocyte [47]. Within an hour after cells were scratched, S1P3 (but not S1P1 or S1P2) mRNA was increased relative to control unscratched cells (Fig. 5a) as was the mRNA level for sphingosine kinase 1 (Sphk1), the enzyme that catalyzes the synthesis of S1P (Fig. 5b) [54]. Our previous studies showed that injuring astrocytes increases COX-2 expression and that the media from scratched cells contains substances that contribute to this response [40]. To determine whether this localized inflammatory response could be mediated by the actions of S1P, formed from the elevated Sphk1 and acting on astrocyte S1P3, we repeated the scratch injury studies using S1P3 KO astrocytes. The increase in COX-2 protein expression was lost, indicating that the ability of scratch to elicit this response requires S1P3 (Fig. 5c). We confirmed this further by comparing wild-type cells that were subject to scratch injury in the presence or absence of the S1P3 inhibitor SPM-354 used in Fig. 1d. Pharmacological blockade of S1P3, like genetic deletion of the receptor, prevented scratch-induced COX-2 expression (Fig. 5d). Finally, to test the importance of localized formation of S1P, we knocked down Sphk1 using siRNA (90% reduction in Sphk1). Scratch injury failed to increase COX-2 protein expression when Sphk1 was downregulated (Fig. 5e) implicating this enzyme, its product, and S1P3 activation in localized astrocyte COX-2 induction.

Discussion

Neuroinflammation, which underlies many neurodegenerative processes including those involved in Alzheimer’s disease, Parkinson’s disease, and MS, is increasingly recognized as a hallmark of CNS pathology [19, 20, 5558]. Astrocytes were once considered as structural elements in the brain but subsequently emerged as functionally important for neuronal guidance, maintenance of the BBB, and structural and metabolic support of neurons [15, 17, 18]. In addition, astrocytes, like microglia, are now known to contribute to neuroinflammation [14, 17, 19, 56, 59]. The lysophospholipid S1P regulates astrogliosis and inflammatory responses in the CNS; however, the role of the individual S1P receptor subtypes in these processes has not been clearly delineated [23, 30, 31, 33, 34, 60, 61].
Astrocytes contribute to neuroinflammation by upregulating proinflammatory mediators such us IL-6, MCP-1, TNF-α, iNOS, and COX-2 [15, 17, 40, 62]. Induction of COX-2 in astrocytes increases generation of reactive oxygen species (ROS), as well as formation of prostanoids that play a prominent role in inflammation, and thus further contribute to neuronal cell death and demyelination in diseases such as MS [20, 56]. Moreover, astrocytes produce VEGF which plays a role in the breakdown of the blood-brain barrier, a step critical to the entry of pathogenic lymphocytes into the brain [6367]. Our data demonstrate that an important mechanism for induction of inflammatory cytokines and cytotoxic mediators such as IL-6, COX-2, and VEGFa in astrocytes is through their exposure to S1P and activation of S1P3.
Both S1P1 and S1P3 are expressed on astrocytes [8, 12] and are upregulated on reactive astrocytes that contribute to inflammation associated with CNS disease [32, 33, 35, 61, 68]. In response to inflammatory stimuli or in CNS pathologies, Sphk1, an enzyme that generates S1P, is also increased in astroglial cells [23, 34, 35, 69, 70]. Our findings using siRNA and S1P3 KO astrocytes demonstrate mechanistically that agonist binding to S1P3 signals to inflammatory responses through S1P3 coupling to Gα12/13 and activation of RhoA. We also show here, using an astrocyte scratch injury assay, that S1P3 and Sphk1 expression are increased by simulated inflammation and demonstrate by their knockout and downregulation, respectively, that they are involved in an autocrine signaling loop to increase COX-2 expression. While S1P2 could also signal through Gα12/13 and RhoA to contribute to COX-2 expression ([37, 7173] and Fig. 4) and appears to serve this role when S1P3 is downregulated (Fig. 1b), the relatively low expression of this receptor subtype and its lack of upregulation in response to wounding suggests limited involvement in astrocyte inflammatory responses (Fig. 1c). Thus, it appears that S1P3, and its autocrine activation by S1P generated through Sphk1, are poised to mediate astrocytic inflammatory responses that could contribute to the progression of CNS neuropathology.
S1P signaling in the CNS has important pathophysiological consequences [21, 2830, 3335, 40, 61, 74]. Much research has focused on S1P1 as the primary target for the MS drug FTY720 (fingolimod). While a well-recognized effect of fingolimod is to functionally antagonize S1P1 receptors on lymphocytes and thereby prevent their egress into the blood and access to the brain, S1P1 localized to astrocytes contributes significantly to the effects of this drug in an experimental model of MS [75]. The basis for also considering S1P3 signaling in MS is that this receptor subtype is upregulated in astrocytes during MS and in EAE and that it is a target for fingolimod [33, 61]. Notably, fingolimod causes transient bradycardia that appears, at least in the mouse, to be due to its agonist actions on S1P3 [24, 25, 7678]. While it is clear that fingolimod downregulates S1P1, and thus acts as a functional antagonist, its ability to similarly downregulate and thus act as a functional antagonist of S1P3 is controversial [61, 77, 79, 80]. A recent study demonstrated that continuous treatment with FTY20, initiated at the onset of disease in an EAE model, reduced S1P3 expression at day 22 [61]. While this indicates that S1P3 is downregulated by FTY720 treatment, this could reflect reversal of the disease process/inflammation (and its accompanying increases in S1P3 gene expression) rather than downregulation at the receptor level. Our data with FTY720 (like that examining bradycardia) demonstrate that FTY720 acts as an agonist, eliciting COX-2 induction, over a period of at least 6 h. Our data further establish that it is S1P3-mediated RhoA signaling, not effects of S1P1 and Gαi, that lead to maladaptive astrocyte inflammation. Thus, agonism at astrocyte S1P3 by fingolimod or other drugs could contribute to neuroinflammation and worsen disease progression, particularly when S1P3 are upregulated and S1P availability increased through activation of sphingosine kinase. Further studies using S1P1/3 double knockout mice are ongoing and should indicate whether blocking S1P3, in addition to S1P1, would have additional therapeutic benefit.
The importance of S1P3 and RhoA signaling in CNS disease could be logically extended to consideration of any of the myriad GPCRs found on astrocytes [32] that couple to RhoA signaling. We and others have shown that PAR1, the receptor for thrombin, couples through RhoA to mediate proliferation and inflammatory responses in astrocytes [39, 40]. Thrombin is also increased in the injured brain [81, 82], and an antagonist of protease activated receptor 1 (PAR1) reduces clinical symptoms in EAE mice [83]. Thus, the evidence that S1P3 and other GPCRs that stimulate RhoA can contribute to sustained inflammatory responses suggests this pathway as a critical target for blocking neuroinflammation in MS and other CNS diseases.

Conclusions

Our findings demonstrate that S1P3 and Sphk1 are mediators of inflammatory signaling and are upregulated in astrocytes in response to injury. S1P3 couples to Gα12/13 and activated RhoA to induce COX-2, IL-6, and VEGFa mRNA as well as COX-2 protein expression in astrocytes. The data suggest that blocking S1P3, as well as the clinically relevant S1P1, could have therapeutic benefit for limiting CNS inflammatory disease progression.

Acknowledgements

We thank Melissa S. Barlow for her capable assistance with the animal breeding and genotyping and Jeffery M. Smith for the technical assistance.

Funding

This work was supported by National Institutes of Health Grants T32GM007752 (to S.S.D.), HL114949 (to N.H.P.), MH084512 (to H.R.), DA019674 (to J.C.), and HL028143 and GM36927 (to J.H.B.).

Availability of data and materials

Not applicable

Authors’ contributions

SSD, NHP, and JHB designed of the study, carried out the experiments, and participated in the data analysis and manuscript preparation. JC and HR contributed to the data analysis and interpretation of the results. All authors reviewed the results and approved the final version of the manuscript.

Competing interests

The authors declare that they have no competing interests.
Not applicable

Ethics approval

All procedures were performed in accordance with NIH Guide and Care and Use of Laboratory Animals and approved by the Institutional Animal Care and Use Committee at the University of California San Diego.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
Zurück zum Zitat Camerer E, Regard JB, Cornelissen I, Srinivasan Y, Duong DN, Palmer D, Pham TH, Wong JS, Pappu R, Coughlin SR. Sphingosine-1-phosphate in the plasma compartment regulates basal and inflammation-induced vascular leak in mice. J Clin Invest. 2009;119:1871–9.PubMedPubMedCentral Camerer E, Regard JB, Cornelissen I, Srinivasan Y, Duong DN, Palmer D, Pham TH, Wong JS, Pappu R, Coughlin SR. Sphingosine-1-phosphate in the plasma compartment regulates basal and inflammation-induced vascular leak in mice. J Clin Invest. 2009;119:1871–9.PubMedPubMedCentral
2.
Zurück zum Zitat Anelli V, Bassi R, Tettamanti G, Viani P, Riboni L. Extracellular release of newly synthesized sphingosine-1-phosphate by cerebellar granule cells and astrocytes. J Neurochem. 2005;92:1204–15.CrossRefPubMed Anelli V, Bassi R, Tettamanti G, Viani P, Riboni L. Extracellular release of newly synthesized sphingosine-1-phosphate by cerebellar granule cells and astrocytes. J Neurochem. 2005;92:1204–15.CrossRefPubMed
3.
Zurück zum Zitat Pappu R, Schwab SR, Cornelissen I, Pereira JP, Regard JB, Xu Y, Camerer E, Zheng YW, Huang Y, Cyster JG, Coughlin SR. Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science. 2007;316:295–8.CrossRefPubMed Pappu R, Schwab SR, Cornelissen I, Pereira JP, Regard JB, Xu Y, Camerer E, Zheng YW, Huang Y, Cyster JG, Coughlin SR. Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science. 2007;316:295–8.CrossRefPubMed
4.
Zurück zum Zitat Yatomi Y, Ohmori T, Rile G, Kazama F, Okamoto H, Sano T, Satoh K, Kume S, Tigyi G, Igarashi Y, Ozaki Y. Sphingosine 1-phosphate as a major bioactive lysophospholipid that is released from platelets and interacts with endothelial cells. Blood. 2000;96:3431–8.PubMed Yatomi Y, Ohmori T, Rile G, Kazama F, Okamoto H, Sano T, Satoh K, Kume S, Tigyi G, Igarashi Y, Ozaki Y. Sphingosine 1-phosphate as a major bioactive lysophospholipid that is released from platelets and interacts with endothelial cells. Blood. 2000;96:3431–8.PubMed
5.
Zurück zum Zitat Yatomi Y, Igarashi Y, Yang L, Hisano N, Qi R, Asazuma N, Satoh K, Ozaki Y, Kume S. Sphingosine 1-phosphate, a bioactive sphingolipid abundantly stored in platelets, is a normal constituent of human plasma and serum. J Biochem. 1997;121:969–73.CrossRefPubMed Yatomi Y, Igarashi Y, Yang L, Hisano N, Qi R, Asazuma N, Satoh K, Ozaki Y, Kume S. Sphingosine 1-phosphate, a bioactive sphingolipid abundantly stored in platelets, is a normal constituent of human plasma and serum. J Biochem. 1997;121:969–73.CrossRefPubMed
6.
Zurück zum Zitat Ishii I, Fukushima N, Ye X, Chun J. Lysophospholipid receptors: signaling and biology. Annu Rev Biochem. 2004;73:321–54.CrossRefPubMed Ishii I, Fukushima N, Ye X, Chun J. Lysophospholipid receptors: signaling and biology. Annu Rev Biochem. 2004;73:321–54.CrossRefPubMed
7.
8.
Zurück zum Zitat Rao TS, Lariosa-Willingham KD, Lin FF, Palfreyman EL, Yu N, Chun J, Webb M. Pharmacological characterization of lysophospholipid receptor signal transduction pathways in rat cerebrocortical astrocytes. Brain Res. 2003;990:182–94.CrossRefPubMed Rao TS, Lariosa-Willingham KD, Lin FF, Palfreyman EL, Yu N, Chun J, Webb M. Pharmacological characterization of lysophospholipid receptor signal transduction pathways in rat cerebrocortical astrocytes. Brain Res. 2003;990:182–94.CrossRefPubMed
9.
Zurück zum Zitat Tham CS, Lin FF, Rao TS, Yu N, Webb M. Microglial activation state and lysophospholipid acid receptor expression. Int J Dev Neurosci. 2003;21:431–43.CrossRefPubMed Tham CS, Lin FF, Rao TS, Yu N, Webb M. Microglial activation state and lysophospholipid acid receptor expression. Int J Dev Neurosci. 2003;21:431–43.CrossRefPubMed
10.
Zurück zum Zitat Toman RE, Payne SG, Watterson KR, Maceyka M, Lee NH, Milstien S, Bigbee JW, Spiegel S. Differential transactivation of sphingosine-1-phosphate receptors modulates NGF-induced neurite extension. J Cell Biol. 2004;166:381–92.CrossRefPubMedPubMedCentral Toman RE, Payne SG, Watterson KR, Maceyka M, Lee NH, Milstien S, Bigbee JW, Spiegel S. Differential transactivation of sphingosine-1-phosphate receptors modulates NGF-induced neurite extension. J Cell Biol. 2004;166:381–92.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Yu N, Lariosa-Willingham KD, Lin FF, Webb M, Rao TS. Characterization of lysophosphatidic acid and sphingosine-1-phosphate-mediated signal transduction in rat cortical oligodendrocytes. Glia. 2004;45:17–27.CrossRefPubMed Yu N, Lariosa-Willingham KD, Lin FF, Webb M, Rao TS. Characterization of lysophosphatidic acid and sphingosine-1-phosphate-mediated signal transduction in rat cortical oligodendrocytes. Glia. 2004;45:17–27.CrossRefPubMed
12.
Zurück zum Zitat Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, Phatnani HP, Guarnieri P, Caneda C, Ruderisch N, Deng S, Liddelow SA, Zhang C, Daneman R, Maniatis T, Barres BA, Wu JQ. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci. 2014;34:11929–47.CrossRefPubMedPubMedCentral Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, Phatnani HP, Guarnieri P, Caneda C, Ruderisch N, Deng S, Liddelow SA, Zhang C, Daneman R, Maniatis T, Barres BA, Wu JQ. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci. 2014;34:11929–47.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Choi JW, Chun J. Lysophospholipids and their receptors in the central nervous system. Biochim Biophys Acta. 2013;1:20–32. Choi JW, Chun J. Lysophospholipids and their receptors in the central nervous system. Biochim Biophys Acta. 2013;1:20–32.
15.
Zurück zum Zitat Ridet JL, Malhotra SK, Privat A, Gage FH. Reactive astrocytes: cellular and molecular cues to biological function. Trends Neurosci. 1997;20:570–7.CrossRefPubMed Ridet JL, Malhotra SK, Privat A, Gage FH. Reactive astrocytes: cellular and molecular cues to biological function. Trends Neurosci. 1997;20:570–7.CrossRefPubMed
17.
Zurück zum Zitat Sofroniew MV. Multiple roles for astrocytes as effectors of cytokines and inflammatory mediators. Neuroscientist. 2014;20:160–72.CrossRefPubMed Sofroniew MV. Multiple roles for astrocytes as effectors of cytokines and inflammatory mediators. Neuroscientist. 2014;20:160–72.CrossRefPubMed
18.
Zurück zum Zitat Sofroniew MV, Vinters HV. Astrocytes: biology and pathology. Acta Neuropathol. 2010;119:7–35.CrossRefPubMed Sofroniew MV, Vinters HV. Astrocytes: biology and pathology. Acta Neuropathol. 2010;119:7–35.CrossRefPubMed
19.
Zurück zum Zitat Miljkovic D, Timotijevic G, Mostarica Stojkovic M. Astrocytes in the tempest of multiple sclerosis. FEBS Lett. 2011;585:3781–8.CrossRefPubMed Miljkovic D, Timotijevic G, Mostarica Stojkovic M. Astrocytes in the tempest of multiple sclerosis. FEBS Lett. 2011;585:3781–8.CrossRefPubMed
20.
Zurück zum Zitat Williams A, Piaton G, Lubetzki C. Astrocytes—friends or foes in multiple sclerosis? Glia. 2007;55:1300–12.CrossRefPubMed Williams A, Piaton G, Lubetzki C. Astrocytes—friends or foes in multiple sclerosis? Glia. 2007;55:1300–12.CrossRefPubMed
21.
Zurück zum Zitat Sorensen SD, Nicole O, Peavy RD, Montoya LM, Lee CJ, Murphy TJ, Traynelis SF, Hepler JR. Common signaling pathways link activation of murine PAR-1, LPA, and S1P receptors to proliferation of astrocytes. Mol Pharmacol. 2003;64:1199–209.CrossRefPubMed Sorensen SD, Nicole O, Peavy RD, Montoya LM, Lee CJ, Murphy TJ, Traynelis SF, Hepler JR. Common signaling pathways link activation of murine PAR-1, LPA, and S1P receptors to proliferation of astrocytes. Mol Pharmacol. 2003;64:1199–209.CrossRefPubMed
22.
Zurück zum Zitat Pebay A, Toutant M, Premont J, Calvo CF, Venance L, Cordier J, Glowinski J, Tence M. Sphingosine-1-phosphate induces proliferation of astrocytes: regulation by intracellular signalling cascades. Eur J Neurosci. 2001;13:2067–76.CrossRef Pebay A, Toutant M, Premont J, Calvo CF, Venance L, Cordier J, Glowinski J, Tence M. Sphingosine-1-phosphate induces proliferation of astrocytes: regulation by intracellular signalling cascades. Eur J Neurosci. 2001;13:2067–76.CrossRef
23.
Zurück zum Zitat Moon E, Han JE, Jeon S, Ryu JH, Choi JW, Chun J. Exogenous S1P exposure potentiates ischemic stroke damage that is reduced possibly by inhibiting S1P receptor signaling. Mediators Inflamm. 2015;2015:492659.CrossRefPubMedPubMedCentral Moon E, Han JE, Jeon S, Ryu JH, Choi JW, Chun J. Exogenous S1P exposure potentiates ischemic stroke damage that is reduced possibly by inhibiting S1P receptor signaling. Mediators Inflamm. 2015;2015:492659.CrossRefPubMedPubMedCentral
24.
Zurück zum Zitat Cohen JA, Barkhof F, Comi G, Hartung HP, Khatri BO, Montalban X, Pelletier J, Capra R, Gallo P, Izquierdo G, Tiel-Wilck K, de Vera A, Jin J, Stites T, Wu S, Aradhye S, Kappos L. Oral fingolimod or intramuscular interferon for relapsing multiple sclerosis. N Engl J Med. 2010;362:402–15.CrossRefPubMed Cohen JA, Barkhof F, Comi G, Hartung HP, Khatri BO, Montalban X, Pelletier J, Capra R, Gallo P, Izquierdo G, Tiel-Wilck K, de Vera A, Jin J, Stites T, Wu S, Aradhye S, Kappos L. Oral fingolimod or intramuscular interferon for relapsing multiple sclerosis. N Engl J Med. 2010;362:402–15.CrossRefPubMed
25.
Zurück zum Zitat Kappos L, Radue EW, O'Connor P, Polman C, Hohlfeld R, Calabresi P, Selmaj K, Agoropoulou C, Leyk M, Zhang-Auberson L, Burtin P. A placebo-controlled trial of oral fingolimod in relapsing multiple sclerosis. N Engl J Med. 2010;362:387–401.CrossRefPubMed Kappos L, Radue EW, O'Connor P, Polman C, Hohlfeld R, Calabresi P, Selmaj K, Agoropoulou C, Leyk M, Zhang-Auberson L, Burtin P. A placebo-controlled trial of oral fingolimod in relapsing multiple sclerosis. N Engl J Med. 2010;362:387–401.CrossRefPubMed
26.
Zurück zum Zitat Cohen JA, Chun J. Mechanisms of fingolimod's efficacy and adverse effects in multiple sclerosis. Ann Neurol. 2011;69:759–77.CrossRefPubMed Cohen JA, Chun J. Mechanisms of fingolimod's efficacy and adverse effects in multiple sclerosis. Ann Neurol. 2011;69:759–77.CrossRefPubMed
27.
Zurück zum Zitat Kihara Y, Mizuno H, Chun J. Lysophospholipid receptors in drug discovery. Exp Cell Res. 2015;333:171–7.CrossRefPubMed Kihara Y, Mizuno H, Chun J. Lysophospholipid receptors in drug discovery. Exp Cell Res. 2015;333:171–7.CrossRefPubMed
28.
Zurück zum Zitat Brinkmann V, Lynch KR. FTY720: targeting G-protein-coupled receptors for sphingosine 1-phosphate in transplantation and autoimmunity. Curr Opin Immunol. 2002;14:569–75.CrossRefPubMed Brinkmann V, Lynch KR. FTY720: targeting G-protein-coupled receptors for sphingosine 1-phosphate in transplantation and autoimmunity. Curr Opin Immunol. 2002;14:569–75.CrossRefPubMed
29.
Zurück zum Zitat Mandala S, Hajdu R, Bergstrom J, Quackenbush E, Xie J, Milligan J, Thornton R, Shei GJ, Card D, Keohane C, Rosenbach M, Hale J, Lynch CL, Rupprecht K, Parsons W, Rosen H. Alteration of lymphocyte trafficking by sphingosine-1-phosphate receptor agonists. Science. 2002;296:346–9.CrossRefPubMed Mandala S, Hajdu R, Bergstrom J, Quackenbush E, Xie J, Milligan J, Thornton R, Shei GJ, Card D, Keohane C, Rosenbach M, Hale J, Lynch CL, Rupprecht K, Parsons W, Rosen H. Alteration of lymphocyte trafficking by sphingosine-1-phosphate receptor agonists. Science. 2002;296:346–9.CrossRefPubMed
30.
Zurück zum Zitat Choi JW, Gardell SE, Herr DR, Rivera R, Lee CW, Noguchi K, Teo ST, Yung YC, Lu M, Kennedy G, Chun J. FTY720 (fingolimod) efficacy in an animal model of multiple sclerosis requires astrocyte sphingosine 1-phosphate receptor 1 (S1P1) modulation. Proc Natl Acad Sci U S A. 2011;108:751–6.CrossRefPubMed Choi JW, Gardell SE, Herr DR, Rivera R, Lee CW, Noguchi K, Teo ST, Yung YC, Lu M, Kennedy G, Chun J. FTY720 (fingolimod) efficacy in an animal model of multiple sclerosis requires astrocyte sphingosine 1-phosphate receptor 1 (S1P1) modulation. Proc Natl Acad Sci U S A. 2011;108:751–6.CrossRefPubMed
31.
Zurück zum Zitat Mullershausen F, Craveiro LM, Shin Y, Cortes-Cros M, Bassilana F, Osinde M, Wishart WL, Guerini D, Thallmair M, Schwab ME, Sivasankaran R, Seuwen K, Dev KK. Phosphorylated FTY720 promotes astrocyte migration through sphingosine-1-phosphate receptors. J Neurochem. 2007;102:1151–61.CrossRefPubMed Mullershausen F, Craveiro LM, Shin Y, Cortes-Cros M, Bassilana F, Osinde M, Wishart WL, Guerini D, Thallmair M, Schwab ME, Sivasankaran R, Seuwen K, Dev KK. Phosphorylated FTY720 promotes astrocyte migration through sphingosine-1-phosphate receptors. J Neurochem. 2007;102:1151–61.CrossRefPubMed
32.
Zurück zum Zitat Hamby ME, Coppola G, Ao Y, Geschwind DH, Khakh BS, Sofroniew MV. Inflammatory mediators alter the astrocyte transcriptome and calcium signaling elicited by multiple G-protein-coupled receptors. J Neurosci. 2012;32:14489–510.CrossRefPubMedPubMedCentral Hamby ME, Coppola G, Ao Y, Geschwind DH, Khakh BS, Sofroniew MV. Inflammatory mediators alter the astrocyte transcriptome and calcium signaling elicited by multiple G-protein-coupled receptors. J Neurosci. 2012;32:14489–510.CrossRefPubMedPubMedCentral
33.
Zurück zum Zitat Van Doorn R, Van Horssen J, Verzijl D, Witte M, Ronken E, Van Het Hof B, Lakeman K, Dijkstra CD, Van Der Valk P, Reijerkerk A, Alewijnse AE, Peters SL, De Vries HE. Sphingosine 1-phosphate receptor 1 and 3 are upregulated in multiple sclerosis lesions. Glia. 2010;58:1465–76.PubMed Van Doorn R, Van Horssen J, Verzijl D, Witte M, Ronken E, Van Het Hof B, Lakeman K, Dijkstra CD, Van Der Valk P, Reijerkerk A, Alewijnse AE, Peters SL, De Vries HE. Sphingosine 1-phosphate receptor 1 and 3 are upregulated in multiple sclerosis lesions. Glia. 2010;58:1465–76.PubMed
34.
Zurück zum Zitat Fischer I, Alliod C, Martinier N, Newcombe J, Brana C, Pouly S. Sphingosine kinase 1 and sphingosine 1-phosphate receptor 3 are functionally upregulated on astrocytes under pro-inflammatory conditions. PLoS One. 2011;6:e23905.CrossRefPubMedPubMedCentral Fischer I, Alliod C, Martinier N, Newcombe J, Brana C, Pouly S. Sphingosine kinase 1 and sphingosine 1-phosphate receptor 3 are functionally upregulated on astrocytes under pro-inflammatory conditions. PLoS One. 2011;6:e23905.CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Wu YP, Mizugishi K, Bektas M, Sandhoff R, Proia RL. Sphingosine kinase 1/S1P receptor signaling axis controls glial proliferation in mice with Sandhoff disease. Hum Mol Genet. 2008;17:2257–64.CrossRefPubMedPubMedCentral Wu YP, Mizugishi K, Bektas M, Sandhoff R, Proia RL. Sphingosine kinase 1/S1P receptor signaling axis controls glial proliferation in mice with Sandhoff disease. Hum Mol Genet. 2008;17:2257–64.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Ishii I, Ye X, Friedman B, Kawamura S, Contos JJ, Kingsbury MA, Yang AH, Zhang G, Brown JH, Chun J. Marked perinatal lethality and cellular signaling deficits in mice null for the two sphingosine 1-phosphate (S1P) receptors, S1P(2)/LP(B2)/EDG-5 and S1P(3)/LP(B3)/EDG-3. J Biol Chem. 2002;277:25152–9.CrossRefPubMed Ishii I, Ye X, Friedman B, Kawamura S, Contos JJ, Kingsbury MA, Yang AH, Zhang G, Brown JH, Chun J. Marked perinatal lethality and cellular signaling deficits in mice null for the two sphingosine 1-phosphate (S1P) receptors, S1P(2)/LP(B2)/EDG-5 and S1P(3)/LP(B3)/EDG-3. J Biol Chem. 2002;277:25152–9.CrossRefPubMed
37.
Zurück zum Zitat Siehler S, Manning DR. Pathways of transduction engaged by sphingosine 1-phosphate through G protein-coupled receptors. Biochim Biophys Acta. 2002;1582:94–9.CrossRefPubMed Siehler S, Manning DR. Pathways of transduction engaged by sphingosine 1-phosphate through G protein-coupled receptors. Biochim Biophys Acta. 2002;1582:94–9.CrossRefPubMed
38.
39.
Zurück zum Zitat Dusaban SS, Kunkel MT, Smrcka AV, Brown JH. Thrombin promotes sustained signaling and inflammatory gene expression through the CDC25 and Ras-associating domains of phospholipase C-epsilon. J Biol Chem. 2015;44:26776–83. Dusaban SS, Kunkel MT, Smrcka AV, Brown JH. Thrombin promotes sustained signaling and inflammatory gene expression through the CDC25 and Ras-associating domains of phospholipase C-epsilon. J Biol Chem. 2015;44:26776–83.
40.
Zurück zum Zitat Dusaban SS, Purcell NH, Rockenstein E, Masliah E, Cho MK, Smrcka AV, Brown JH. Phospholipase C epsilon links G protein-coupled receptor activation to inflammatory astrocytic responses. Proc Natl Acad Sci U S A. 2013;110:3609–14.CrossRefPubMedPubMedCentral Dusaban SS, Purcell NH, Rockenstein E, Masliah E, Cho MK, Smrcka AV, Brown JH. Phospholipase C epsilon links G protein-coupled receptor activation to inflammatory astrocytic responses. Proc Natl Acad Sci U S A. 2013;110:3609–14.CrossRefPubMedPubMedCentral
41.
Zurück zum Zitat Post GR, Collins LR, Kennedy ED, Moskowitz SA, Aragay AM, Goldstein D, Brown JH. Coupling of the thrombin receptor to G12 may account for selective effects of thrombin on gene expression and DNA synthesis in 1321N1 astrocytoma cells. Mol Biol Cell. 1996;7:1679–90.CrossRefPubMedPubMedCentral Post GR, Collins LR, Kennedy ED, Moskowitz SA, Aragay AM, Goldstein D, Brown JH. Coupling of the thrombin receptor to G12 may account for selective effects of thrombin on gene expression and DNA synthesis in 1321N1 astrocytoma cells. Mol Biol Cell. 1996;7:1679–90.CrossRefPubMedPubMedCentral
42.
Zurück zum Zitat Walsh CT, Radeff-Huang J, Matteo R, Hsiao A, Subramaniam S, Stupack D, Brown JH. Thrombin receptor and RhoA mediate cell proliferation through integrins and cysteine-rich protein 61. FASEB J. 2008;22:4011–21.CrossRefPubMedPubMedCentral Walsh CT, Radeff-Huang J, Matteo R, Hsiao A, Subramaniam S, Stupack D, Brown JH. Thrombin receptor and RhoA mediate cell proliferation through integrins and cysteine-rich protein 61. FASEB J. 2008;22:4011–21.CrossRefPubMedPubMedCentral
43.
Zurück zum Zitat Yu OM, Miyamoto S, Brown JH. Myocardin-related transcription factor a and yes-associated protein exert dual control in G protein-coupled receptor- and RhoA-mediated transcriptional regulation and cell proliferation. Mol Cell Biol. 2015;36:39–49.PubMedPubMedCentral Yu OM, Miyamoto S, Brown JH. Myocardin-related transcription factor a and yes-associated protein exert dual control in G protein-coupled receptor- and RhoA-mediated transcriptional regulation and cell proliferation. Mol Cell Biol. 2015;36:39–49.PubMedPubMedCentral
44.
Zurück zum Zitat Citro S, Malik S, Oestreich EA, Radeff-Huang J, Kelley GG, Smrcka AV, Brown JH. Phospholipase Cepsilon is a nexus for Rho and Rap-mediated G protein-coupled receptor-induced astrocyte proliferation. Proc Natl Acad Sci U S A. 2007;104:15543–8.CrossRefPubMedPubMedCentral Citro S, Malik S, Oestreich EA, Radeff-Huang J, Kelley GG, Smrcka AV, Brown JH. Phospholipase Cepsilon is a nexus for Rho and Rap-mediated G protein-coupled receptor-induced astrocyte proliferation. Proc Natl Acad Sci U S A. 2007;104:15543–8.CrossRefPubMedPubMedCentral
45.
Zurück zum Zitat Sanna MG, Vincent KP, Repetto E, Nguyen N, Brown SJ, Abgaryan L, Riley SW, Leaf NB, Cahalan SM, Kiosses WB, Kohno Y, Brown JH, McCulloch AD, Rosen H, Gonzalez-Cabrera PJ. Bitopic sphingosine 1-phosphate receptor 3 (S1P3) antagonist rescue from complete heart block: pharmacological and genetic evidence for direct S1P3 regulation of mouse cardiac conduction. Mol Pharmacol. 2016;89:176–86.CrossRefPubMedPubMedCentral Sanna MG, Vincent KP, Repetto E, Nguyen N, Brown SJ, Abgaryan L, Riley SW, Leaf NB, Cahalan SM, Kiosses WB, Kohno Y, Brown JH, McCulloch AD, Rosen H, Gonzalez-Cabrera PJ. Bitopic sphingosine 1-phosphate receptor 3 (S1P3) antagonist rescue from complete heart block: pharmacological and genetic evidence for direct S1P3 regulation of mouse cardiac conduction. Mol Pharmacol. 2016;89:176–86.CrossRefPubMedPubMedCentral
46.
Zurück zum Zitat Ishii I, Friedman B, Ye X, Kawamura S, McGiffert C, Contos JJ, Kingsbury MA, Zhang G, Brown JH, Chun J. Selective loss of sphingosine 1-phosphate signaling with no obvious phenotypic abnormality in mice lacking its G protein-coupled receptor, LP(B3)/EDG-3. J Biol Chem. 2001;276:33697–704.CrossRefPubMed Ishii I, Friedman B, Ye X, Kawamura S, McGiffert C, Contos JJ, Kingsbury MA, Zhang G, Brown JH, Chun J. Selective loss of sphingosine 1-phosphate signaling with no obvious phenotypic abnormality in mice lacking its G protein-coupled receptor, LP(B3)/EDG-3. J Biol Chem. 2001;276:33697–704.CrossRefPubMed
47.
Zurück zum Zitat Pan H, Wang H, Wang X, Zhu L, Mao L. The absence of Nrf2 enhances NF-kappaB-dependent inflammation following scratch injury in mouse primary cultured astrocytes. Mediators Inflamm. 2012;2012:217580.CrossRefPubMedPubMedCentral Pan H, Wang H, Wang X, Zhu L, Mao L. The absence of Nrf2 enhances NF-kappaB-dependent inflammation following scratch injury in mouse primary cultured astrocytes. Mediators Inflamm. 2012;2012:217580.CrossRefPubMedPubMedCentral
48.
Zurück zum Zitat Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3:1101–8.CrossRefPubMed Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3:1101–8.CrossRefPubMed
49.
Zurück zum Zitat Means CK, Xiao CY, Li Z, Zhang T, Omens JH, Ishii I, Chun J, Brown JH. Sphingosine 1-phosphate S1P2 and S1P3 receptor-mediated Akt activation protects against in vivo myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 2007;292:H2944–51.CrossRefPubMed Means CK, Xiao CY, Li Z, Zhang T, Omens JH, Ishii I, Chun J, Brown JH. Sphingosine 1-phosphate S1P2 and S1P3 receptor-mediated Akt activation protects against in vivo myocardial ischemia-reperfusion injury. Am J Physiol Heart Circ Physiol. 2007;292:H2944–51.CrossRefPubMed
50.
Zurück zum Zitat Jo E, Bhhatarai B, Repetto E, Guerrero M, Riley S, Brown SJ, Kohno Y, Roberts E, Schurer SC, Rosen H. Novel selective allosteric and bitopic ligands for the S1P(3) receptor. ACS Chem Biol. 2012;7:1975–83.CrossRefPubMedPubMedCentral Jo E, Bhhatarai B, Repetto E, Guerrero M, Riley S, Brown SJ, Kohno Y, Roberts E, Schurer SC, Rosen H. Novel selective allosteric and bitopic ligands for the S1P(3) receptor. ACS Chem Biol. 2012;7:1975–83.CrossRefPubMedPubMedCentral
51.
Zurück zum Zitat Guerrero M, Poddutoori R, Urbano M, Peng X, Spicer TP, Chase PS, Hodder PS, Schaeffer MT, Brown S, Rosen H, Roberts E. Discovery, design and synthesis of a selective S1P(3) receptor allosteric agonist. Bioorg Med Chem Lett. 2013;23:6346–9.CrossRefPubMedPubMedCentral Guerrero M, Poddutoori R, Urbano M, Peng X, Spicer TP, Chase PS, Hodder PS, Schaeffer MT, Brown S, Rosen H, Roberts E. Discovery, design and synthesis of a selective S1P(3) receptor allosteric agonist. Bioorg Med Chem Lett. 2013;23:6346–9.CrossRefPubMedPubMedCentral
52.
Zurück zum Zitat Cen B, Selvaraj A, Burgess RC, Hitzler JK, Ma Z, Morris SW, Prywes R. Megakaryoblastic leukemia 1, a potent transcriptional coactivator for serum response factor (SRF), is required for serum induction of SRF target genes. Mol Cell Biol. 2003;23:6597–608.CrossRefPubMedPubMedCentral Cen B, Selvaraj A, Burgess RC, Hitzler JK, Ma Z, Morris SW, Prywes R. Megakaryoblastic leukemia 1, a potent transcriptional coactivator for serum response factor (SRF), is required for serum induction of SRF target genes. Mol Cell Biol. 2003;23:6597–608.CrossRefPubMedPubMedCentral
53.
Zurück zum Zitat Miralles F, Posern G, Zaromytidou AI, Treisman R. Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell. 2003;113:329–42.CrossRefPubMed Miralles F, Posern G, Zaromytidou AI, Treisman R. Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell. 2003;113:329–42.CrossRefPubMed
54.
Zurück zum Zitat Kohama T, Olivera A, Edsall L, Nagiec MM, Dickson R, Spiegel S. Molecular cloning and functional characterization of murine sphingosine kinase. J Biol Chem. 1998;273:23722–8.CrossRefPubMed Kohama T, Olivera A, Edsall L, Nagiec MM, Dickson R, Spiegel S. Molecular cloning and functional characterization of murine sphingosine kinase. J Biol Chem. 1998;273:23722–8.CrossRefPubMed
55.
Zurück zum Zitat Ellwardt E, Zipp F. Molecular mechanisms linking neuroinflammation and neurodegeneration in MS. Exp Neurol. 2014;262 Pt A:8–17.CrossRefPubMed Ellwardt E, Zipp F. Molecular mechanisms linking neuroinflammation and neurodegeneration in MS. Exp Neurol. 2014;262 Pt A:8–17.CrossRefPubMed
56.
57.
Zurück zum Zitat Heneka MT, O'Banion MK, Terwel D, Kummer MP. Neuroinflammatory processes in Alzheimer's disease. J Neural Transm. 2010;117:919–47.CrossRefPubMed Heneka MT, O'Banion MK, Terwel D, Kummer MP. Neuroinflammatory processes in Alzheimer's disease. J Neural Transm. 2010;117:919–47.CrossRefPubMed
58.
Zurück zum Zitat Minghetti L. Role of COX-2 in inflammatory and degenerative brain diseases. Subcell Biochem. 2007;42:127–41.CrossRefPubMed Minghetti L. Role of COX-2 in inflammatory and degenerative brain diseases. Subcell Biochem. 2007;42:127–41.CrossRefPubMed
60.
Zurück zum Zitat Hoffmann FS, Hofereiter J, Rubsamen H, Melms J, Schwarz S, Faber H, Weber P, Putz B, Loleit V, Weber F, Hohlfeld R, Meinl E, Krumbholz M. Fingolimod induces neuroprotective factors in human astrocytes. J Neuroinflammation. 2015;12:184.CrossRefPubMedPubMedCentral Hoffmann FS, Hofereiter J, Rubsamen H, Melms J, Schwarz S, Faber H, Weber P, Putz B, Loleit V, Weber F, Hohlfeld R, Meinl E, Krumbholz M. Fingolimod induces neuroprotective factors in human astrocytes. J Neuroinflammation. 2015;12:184.CrossRefPubMedPubMedCentral
61.
Zurück zum Zitat Colombo E, Di Dario M, Capitolo E, Chaabane L, Newcombe J, Martino G, Farina C. Fingolimod may support neuroprotection via blockade of astrocyte nitric oxide. Ann Neurol. 2014;76:325–37.CrossRefPubMed Colombo E, Di Dario M, Capitolo E, Chaabane L, Newcombe J, Martino G, Farina C. Fingolimod may support neuroprotection via blockade of astrocyte nitric oxide. Ann Neurol. 2014;76:325–37.CrossRefPubMed
62.
Zurück zum Zitat Burgos M, Fradejas N, Calvo S, Kang SU, Tranque P, Lubec G. A proteomic analysis of PKCepsilon targets in astrocytes: implications for astrogliosis. Amino Acids. 2011;40:641–51.CrossRefPubMed Burgos M, Fradejas N, Calvo S, Kang SU, Tranque P, Lubec G. A proteomic analysis of PKCepsilon targets in astrocytes: implications for astrogliosis. Amino Acids. 2011;40:641–51.CrossRefPubMed
63.
Zurück zum Zitat Schachtrup C, Ryu JK, Helmrick MJ, Vagena E, Galanakis DK, Degen JL, Margolis RU, Akassoglou K. Fibrinogen triggers astrocyte scar formation by promoting the availability of active TGF-beta after vascular damage. J Neurosci. 2010;30:5843–54.CrossRefPubMedPubMedCentral Schachtrup C, Ryu JK, Helmrick MJ, Vagena E, Galanakis DK, Degen JL, Margolis RU, Akassoglou K. Fibrinogen triggers astrocyte scar formation by promoting the availability of active TGF-beta after vascular damage. J Neurosci. 2010;30:5843–54.CrossRefPubMedPubMedCentral
64.
Zurück zum Zitat Argaw AT, Asp L, Zhang J, Navrazhina K, Pham T, Mariani JN, Mahase S, Dutta DJ, Seto J, Kramer EG, Ferrara N, Sofroniew MV, John GR. Astrocyte-derived VEGF-A drives blood-brain barrier disruption in CNS inflammatory disease. J Clin Invest. 2012;7:2454–68. Argaw AT, Asp L, Zhang J, Navrazhina K, Pham T, Mariani JN, Mahase S, Dutta DJ, Seto J, Kramer EG, Ferrara N, Sofroniew MV, John GR. Astrocyte-derived VEGF-A drives blood-brain barrier disruption in CNS inflammatory disease. J Clin Invest. 2012;7:2454–68.
65.
Zurück zum Zitat Haseloff RF, Blasig IE, Bauer HC, Bauer H. In search of the astrocytic factor(s) modulating blood-brain barrier functions in brain capillary endothelial cells in vitro. Cell Mol Neurobiol. 2005;25:25–39.CrossRefPubMed Haseloff RF, Blasig IE, Bauer HC, Bauer H. In search of the astrocytic factor(s) modulating blood-brain barrier functions in brain capillary endothelial cells in vitro. Cell Mol Neurobiol. 2005;25:25–39.CrossRefPubMed
66.
Zurück zum Zitat Abbott NJ, Ronnback L, Hansson E. Astrocyte-endothelial interactions at the blood-brain barrier. Nat Rev Neurosci. 2006;7:41–53.CrossRefPubMed Abbott NJ, Ronnback L, Hansson E. Astrocyte-endothelial interactions at the blood-brain barrier. Nat Rev Neurosci. 2006;7:41–53.CrossRefPubMed
67.
Zurück zum Zitat Baeten KM, Akassoglou K. Extracellular matrix and matrix receptors in blood-brain barrier formation and stroke. Dev Neurobiol. 2011;71:1018–39.CrossRefPubMedPubMedCentral Baeten KM, Akassoglou K. Extracellular matrix and matrix receptors in blood-brain barrier formation and stroke. Dev Neurobiol. 2011;71:1018–39.CrossRefPubMedPubMedCentral
68.
Zurück zum Zitat Garris CS, Wu L, Acharya S, Arac A, Blaho VA, Huang Y, Moon BS, Axtell RC, Ho PP, Steinberg GK, Lewis DB, Sobel RA, Han DK, Steinman L, Snyder MP, Hla T, Han MH. Defective sphingosine 1-phosphate receptor 1 (S1P1) phosphorylation exacerbates TH17-mediated autoimmune neuroinflammation. Nat Immunol. 2013;14:1166–72.CrossRefPubMedPubMedCentral Garris CS, Wu L, Acharya S, Arac A, Blaho VA, Huang Y, Moon BS, Axtell RC, Ho PP, Steinberg GK, Lewis DB, Sobel RA, Han DK, Steinman L, Snyder MP, Hla T, Han MH. Defective sphingosine 1-phosphate receptor 1 (S1P1) phosphorylation exacerbates TH17-mediated autoimmune neuroinflammation. Nat Immunol. 2013;14:1166–72.CrossRefPubMedPubMedCentral
69.
Zurück zum Zitat Paugh BS, Bryan L, Paugh SW, Wilczynska KM, Alvarez SM, Singh SK, Kapitonov D, Rokita H, Wright S, Griswold-Prenner I, Milstien S, Spiegel S, Kordula T. Interleukin-1 regulates the expression of sphingosine kinase 1 in glioblastoma cells. J Biol Chem. 2009;284:3408–17.CrossRefPubMedPubMedCentral Paugh BS, Bryan L, Paugh SW, Wilczynska KM, Alvarez SM, Singh SK, Kapitonov D, Rokita H, Wright S, Griswold-Prenner I, Milstien S, Spiegel S, Kordula T. Interleukin-1 regulates the expression of sphingosine kinase 1 in glioblastoma cells. J Biol Chem. 2009;284:3408–17.CrossRefPubMedPubMedCentral
70.
Zurück zum Zitat Nayak D, Huo Y, Kwang WX, Pushparaj PN, Kumar SD, Ling EA, Dheen ST. Sphingosine kinase 1 regulates the expression of proinflammatory cytokines and nitric oxide in activated microglia. Neuroscience. 2010;166:132–44.CrossRefPubMed Nayak D, Huo Y, Kwang WX, Pushparaj PN, Kumar SD, Ling EA, Dheen ST. Sphingosine kinase 1 regulates the expression of proinflammatory cytokines and nitric oxide in activated microglia. Neuroscience. 2010;166:132–44.CrossRefPubMed
71.
Zurück zum Zitat Volzke A, Koch A, Meyer Zu Heringdorf D, Huwiler A, Pfeilschifter J. Sphingosine 1-phosphate (S1P) induces COX-2 expression and PGE2 formation via S1P receptor 2 in renal mesangial cells. Biochim Biophys Acta. 1841;2014:11–21. Volzke A, Koch A, Meyer Zu Heringdorf D, Huwiler A, Pfeilschifter J. Sphingosine 1-phosphate (S1P) induces COX-2 expression and PGE2 formation via S1P receptor 2 in renal mesangial cells. Biochim Biophys Acta. 1841;2014:11–21.
72.
Zurück zum Zitat Sobel K, Monnier L, Menyhart K, Bolinger M, Studer R, Nayler O, Gatfield J. FTY720 phosphate activates sphingosine-1-phosphate receptor 2 and selectively couples to Galpha12/13/Rho/ROCK to induce myofibroblast contraction. Mol Pharmacol. 2015;87:916–27.CrossRefPubMed Sobel K, Monnier L, Menyhart K, Bolinger M, Studer R, Nayler O, Gatfield J. FTY720 phosphate activates sphingosine-1-phosphate receptor 2 and selectively couples to Galpha12/13/Rho/ROCK to induce myofibroblast contraction. Mol Pharmacol. 2015;87:916–27.CrossRefPubMed
73.
Zurück zum Zitat Skoura A, Sanchez T, Claffey K, Mandala SM, Proia RL, Hla T. Essential role of sphingosine 1-phosphate receptor 2 in pathological angiogenesis of the mouse retina. J Clin Invest. 2007;117:2506–16.CrossRefPubMedPubMedCentral Skoura A, Sanchez T, Claffey K, Mandala SM, Proia RL, Hla T. Essential role of sphingosine 1-phosphate receptor 2 in pathological angiogenesis of the mouse retina. J Clin Invest. 2007;117:2506–16.CrossRefPubMedPubMedCentral
74.
Zurück zum Zitat Bryan L, Kordula T, Spiegel S, Milstien S. Regulation and functions of sphingosine kinases in the brain. Biochim Biophys Acta. 2008;1781:459–66.CrossRefPubMedPubMedCentral Bryan L, Kordula T, Spiegel S, Milstien S. Regulation and functions of sphingosine kinases in the brain. Biochim Biophys Acta. 2008;1781:459–66.CrossRefPubMedPubMedCentral
75.
Zurück zum Zitat Groves A, Kihara Y, Chun J. Fingolimod: direct CNS effects of sphingosine 1-phosphate (S1P) receptor modulation and implications in multiple sclerosis therapy. J Neurol Sci. 2013;328:9–18.CrossRefPubMedPubMedCentral Groves A, Kihara Y, Chun J. Fingolimod: direct CNS effects of sphingosine 1-phosphate (S1P) receptor modulation and implications in multiple sclerosis therapy. J Neurol Sci. 2013;328:9–18.CrossRefPubMedPubMedCentral
76.
Zurück zum Zitat Forrest M, Sun SY, Hajdu R, Bergstrom J, Card D, Doherty G, Hale J, Keohane C, Meyers C, Milligan J, Mills S, Nomura N, Rosen H, Rosenbach M, Shei GJ, Singer II, Tian M, West S, White V, Xie J, Proia RL, Mandala S. Immune cell regulation and cardiovascular effects of sphingosine 1-phosphate receptor agonists in rodents are mediated via distinct receptor subtypes. J Pharmacol Exp Ther. 2004;309:758–68.CrossRefPubMed Forrest M, Sun SY, Hajdu R, Bergstrom J, Card D, Doherty G, Hale J, Keohane C, Meyers C, Milligan J, Mills S, Nomura N, Rosen H, Rosenbach M, Shei GJ, Singer II, Tian M, West S, White V, Xie J, Proia RL, Mandala S. Immune cell regulation and cardiovascular effects of sphingosine 1-phosphate receptor agonists in rodents are mediated via distinct receptor subtypes. J Pharmacol Exp Ther. 2004;309:758–68.CrossRefPubMed
77.
Zurück zum Zitat Brinkmann V, Billich A, Baumruker T, Heining P, Schmouder R, Francis G, Aradhye S, Burtin P. Fingolimod (FTY720): discovery and development of an oral drug to treat multiple sclerosis. Nat Rev Drug Discov. 2010;9:883–97.CrossRefPubMed Brinkmann V, Billich A, Baumruker T, Heining P, Schmouder R, Francis G, Aradhye S, Burtin P. Fingolimod (FTY720): discovery and development of an oral drug to treat multiple sclerosis. Nat Rev Drug Discov. 2010;9:883–97.CrossRefPubMed
78.
Zurück zum Zitat Sanna MG, Liao J, Jo E, Alfonso C, Ahn MY, Peterson MS, Webb B, Lefebvre S, Chun J, Gray N, Rosen H. Sphingosine 1-phosphate (S1P) receptor subtypes S1P1 and S1P3, respectively, regulate lymphocyte recirculation and heart rate. J Biol Chem. 2004;279:13839–48.CrossRefPubMed Sanna MG, Liao J, Jo E, Alfonso C, Ahn MY, Peterson MS, Webb B, Lefebvre S, Chun J, Gray N, Rosen H. Sphingosine 1-phosphate (S1P) receptor subtypes S1P1 and S1P3, respectively, regulate lymphocyte recirculation and heart rate. J Biol Chem. 2004;279:13839–48.CrossRefPubMed
79.
Zurück zum Zitat Sensken SC, Staubert C, Keul P, Levkau B, Schoneberg T, Graler MH. Selective activation of G alpha i mediated signalling of S1P3 by FTY720-phosphate. Cell Signal. 2008;20:1125–33.CrossRefPubMed Sensken SC, Staubert C, Keul P, Levkau B, Schoneberg T, Graler MH. Selective activation of G alpha i mediated signalling of S1P3 by FTY720-phosphate. Cell Signal. 2008;20:1125–33.CrossRefPubMed
80.
Zurück zum Zitat Chun J, Brinkmann V. A mechanistically novel, first oral therapy for multiple sclerosis: the development of fingolimod (FTY720, Gilenya). Discov Med. 2011;12:213–28.PubMedPubMedCentral Chun J, Brinkmann V. A mechanistically novel, first oral therapy for multiple sclerosis: the development of fingolimod (FTY720, Gilenya). Discov Med. 2011;12:213–28.PubMedPubMedCentral
81.
Zurück zum Zitat Nicole O, Goldshmidt A, Hamill CE, Sorensen SD, Sastre A, Lyuboslavsky P, Hepler JR, McKeon RJ, Traynelis SF. Activation of protease-activated receptor-1 triggers astrogliosis after brain injury. J Neurosci. 2005;25:4319–29.CrossRefPubMed Nicole O, Goldshmidt A, Hamill CE, Sorensen SD, Sastre A, Lyuboslavsky P, Hepler JR, McKeon RJ, Traynelis SF. Activation of protease-activated receptor-1 triggers astrogliosis after brain injury. J Neurosci. 2005;25:4319–29.CrossRefPubMed
82.
Zurück zum Zitat Davalos D, Baeten KM, Whitney MA, Mullins ES, Friedman B, Olson ES, Ryu JK, Smirnoff DS, Petersen MA, Bedard C, Degen JL, Tsien RY, Akassoglou K. Early detection of thrombin activity in neuroinflammatory disease. Ann Neurol. 2014;75:303–8.CrossRefPubMedPubMedCentral Davalos D, Baeten KM, Whitney MA, Mullins ES, Friedman B, Olson ES, Ryu JK, Smirnoff DS, Petersen MA, Bedard C, Degen JL, Tsien RY, Akassoglou K. Early detection of thrombin activity in neuroinflammatory disease. Ann Neurol. 2014;75:303–8.CrossRefPubMedPubMedCentral
83.
Zurück zum Zitat Kim HN, Kim YR, Ahn SM, Lee SK, Shin HK, Choi BT. Protease activated receptor-1 antagonist ameliorates the clinical symptoms of experimental autoimmune encephalomyelitis via inhibiting breakdown of blood-brain barrier. J Neurochem. 2015;135:577–88.CrossRefPubMed Kim HN, Kim YR, Ahn SM, Lee SK, Shin HK, Choi BT. Protease activated receptor-1 antagonist ameliorates the clinical symptoms of experimental autoimmune encephalomyelitis via inhibiting breakdown of blood-brain barrier. J Neurochem. 2015;135:577–88.CrossRefPubMed
Metadaten
Titel
Sphingosine 1-phosphate receptor 3 and RhoA signaling mediate inflammatory gene expression in astrocytes
verfasst von
Stephanie S. Dusaban
Jerold Chun
Hugh Rosen
Nicole H. Purcell
Joan Heller Brown
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Journal of Neuroinflammation / Ausgabe 1/2017
Elektronische ISSN: 1742-2094
DOI
https://doi.org/10.1186/s12974-017-0882-x

Weitere Artikel der Ausgabe 1/2017

Journal of Neuroinflammation 1/2017 Zur Ausgabe

Neu in den Fachgebieten Neurologie und Psychiatrie

Fehlerkultur in der Medizin – Offenheit zählt!

Darüber reden und aus Fehlern lernen, sollte das Motto in der Medizin lauten. Und zwar nicht nur im Sinne der Patientensicherheit. Eine negative Fehlerkultur kann auch die Behandelnden ernsthaft krank machen, warnt Prof. Dr. Reinhard Strametz. Ein Plädoyer und ein Leitfaden für den offenen Umgang mit kritischen Ereignissen in Medizin und Pflege.

„Übersichtlicher Wegweiser“: Lauterbachs umstrittener Klinik-Atlas ist online

17.05.2024 Klinik aktuell Nachrichten

Sie sei „ethisch geboten“, meint Gesundheitsminister Karl Lauterbach: mehr Transparenz über die Qualität von Klinikbehandlungen. Um sie abzubilden, lässt er gegen den Widerstand vieler Länder einen virtuellen Klinik-Atlas freischalten.

Hirnblutung unter DOAK und VKA ähnlich bedrohlich

17.05.2024 Direkte orale Antikoagulanzien Nachrichten

Kommt es zu einer nichttraumatischen Hirnblutung, spielt es keine große Rolle, ob die Betroffenen zuvor direkt wirksame orale Antikoagulanzien oder Marcumar bekommen haben: Die Prognose ist ähnlich schlecht.

Was nützt die Kraniektomie bei schwerer tiefer Hirnblutung?

17.05.2024 Hirnblutung Nachrichten

Eine Studie zum Nutzen der druckentlastenden Kraniektomie nach schwerer tiefer supratentorieller Hirnblutung deutet einen Nutzen der Operation an. Für überlebende Patienten ist das dennoch nur eine bedingt gute Nachricht.