Background
Nasopharyngeal carcinoma (NPC) is one of the most common malignancies in southern China and Southeast Asia [
1,
2]. The standard treatment modality for NPC is radiotherapy and platinum-based chemotherapy [
3‐
5]. Significant improvements in therapeutic efficacy have been achieved with the extensive application of intensity-modulated radiotherapy (IMRT) together with concurrent chemotherapy [
6,
7]. Distant metastasis is the main reason of treatment failure [
8]. However, the molecular mechanisms underlying NPC metastasis remain poorly understood.
Metastasis is a complex series of steps in which cancer cells leave the original tumor and spread to other organs via the bloodstream, lymphatic system, or body cavities [
9]. To move toward other organs, cancer cells must extend their plasma membrane forward at the front, forming the leading edge of the cell. Cells extend four different plasma membrane protrusions at the leading edge: lamellipodia, filopodia, podosomes and invadopodia [
10‐
12]. These structures uniquely contribute to cellular motility depending on specific circumstances [
12]. Invadopodia are protrusions that allow focal degradation of the extracellular matrix to facilitate invasion through the tissues. Invadopodium extension in three dimensions (3D) requires force driven by actin polymerization. Demonstration of invadopodia is typically performed on two-dimensional (2D) surfaces coated with extracellular matrix proteins, where the invadopodia are present on the ventral surface [
13‐
15]. Invadopodia degrade the extracellular matrix and require the delivery of vesicles containing matrix-degrading proteases, particularly membrane type 1 metalloprotease (MT1-MMP) from the cellular plasma to invadopodial tip. These vesicles are targeted to invadopodia by the vesicle-tethering exocyst complex [
16].
In mammals, the TOCA family (also named F-BAR proteins) includes three members: TOCA-1 (Transducer of CDC42-dependent actin assembly), CIP4 (CDC42-interacting protein 4), and FBP17 (formin-binding protein 17). CIP4 is implicated in clathrin-mediated endocytosis (CME), during which it senses and promotes membrane curvature through its F-BAR domain and binds to key regulators of actin dynamics (e.g., the nucleation promoting factor N-WASP) and endocytosis (e.g., dynamin) through their SH3 domain [
17,
18]. Furthermore, CIP4 acts as an effector of the small GTPase CDC42 that promotes cell migration in breast cancer [
19,
20].
Here, we demonstrate that by regulating invadopodia formation, assembly and extracellular matrix (ECM) degradation, CIP4 controls cell migration and invasion in response to EGFR signaling. We further demonstrate that CIP4 knock-down (KD) had no overt effect on tumor growth, but impaired the ability of distant metastasis in mouse xenograft models. Consistently, CIP4 expression is increased in NPC compared with nasopharyngeal mucosa. Evaluating the expression of CIP4 in primary tumors from 169 NPCs also revealed that high CIP4 protein levels correlate with worse overall survival (OS) and distant metastasis-free survival (DMFS) in NPC patients.
Methods
Cell culture, cellular growth curve, and colony-formation assays
The human nasopharyngeal carcinoma cell lines 5-8F and S18 were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% FBS at 37 °C and 5% CO2.
Cellular growth curves were plotted by using the cellular viability values assessed by the MTT method (Cell Titer 96 Aqueous One Solution Cell Proliferation Assay solution; Sigma). Briefly, 1000 cells/200 μl of medium were seeded into a 96-well plate (Corning) and cultured under normal conditions. At various time points after seeding, the cells in each well were stained with MTT (Sigma, M2128) for 3 h. Then, medium was discarded, and 200 μl of DMSO was added to each well and incubated for 10 min, and the OD490 was determined with a microplate reader.
For the colony-formation assays, 500 cells/2 ml were seeded into a 6-well plate (Corning). After 10 days, the cells were washed with phosphate-buffered saline (PBS), fixed with methanol for 15 min at room temperature, and stained with 1% crystal violet for 20 min. The colonies were counted. All experiments were independently repeated at least three times.
RNA isolation and real-time quantitative reverse-transcription PCR (qPCR)
Total RNA was extracted from cultured cell lines using TRIzol reagent (Invitrogen) and subjected to reverse transcription using a cDNA Synthesis Kit (Thermo, K1622). Real-time qPCR was performed using a SYBR FAST Universal qPCR Kit (KAPA, KK4602). The relative expression levels of the target genes were calculated as two power values of ΔCt (the Ct of GAPDH or CIP4 minus the Ct of the target gene). The sequences of the PCR primers used for amplification were as follows:
-
GAPDH forward, 5′- GTCTCCTCTGACTTCAACAGCG -3′;
-
GAPDH reverse, 5′- ACCACCCTGTTGCTGTAGCCAA -3′;
-
CIP4 forward, 5′- CGAATATGCGGCTCAACTGCAG -3′;
-
CIP4 reverse, 5′- CCTGCGTTCATCCATGTCTTGG -3′.
Small interfering RNA transfection
The negative control small interfering RNA (NC) was purchased from RIBOBIO, and siRNA sequences targeting human CIP4 are 5′- GCATGAAGGTGGCTGCAAA-3′(si#1) and 5′- CCGAAGTGGAACAGGCTTA -3′(si#2). Transient transfections of NPC cells were performed as described previously using the Lipofectamine RNAiMAX Reagent (Invitrogen) protocol. Briefly, 60 pmol siRNA was mixed with Opti-MEM Medium (Invitrogen) and incubated at room temperature for 15 min. Then, the mixture was added to the cells.
Lentiviral transduction studies
Cell lines stably expressing CIP4 short hairpin RNA (shRNA) or a negative control shRNA were purchased from FulenGen Co. Ltd. (Guangzhou, China). Lentiviruses were produced by 293T cells with one of the shRNA using X-tremeGENE DNA transfection reagents (Roche). Infectious lentiviruses were harvested 48 h after transfection and filtered through 0.45 mm filter (Millipore, Bedford, MA). Cells were transduced with lentiviruses CIP4 shRNA or negative control shRNA and then cultured in medium containing 2 mg/ml puromycin (Sigma) for 3 days for selection. CIP4 knockdown efficiency was determined by immunoblotting.
Immunoblotting
Immunoblotting was performed using the standard protocol. The primary antibodies, including rabbit anti-human CIP4 polyclonal antibody (Proteintech), rabbit anti-human N-WASP polyclonal antibody (Proteintech), rabbit anti-human phospho-N-WASP polyclonal antibody (Abcam), rabbit anti-human MMP2 polyclonal antibody (Cell Signaling Technology), rabbit anti-human MMP9 polyclonal antibody (Cell Signaling Technology), rabbit anti-human ERK1/2 polyclonal antibody (Cell Signaling Technology), rabbit anti-human phospho-ERK polyclonal antibody (Cell Signaling Technology), rabbit anti-human EGFR polyclonal antibody (Cell Signaling Technology), rabbit anti-human phosphor-EGFR polyclonal antibody (Cell Signaling Technology), rabbit anti-human AKT1 polyclonal antibody (Cell Signaling Technology), rabbit anti-human phospho-AKT polyclonal antibody (Cell Signaling Technology) and β-actin polyclonal antibody (Cell Signaling Technology) were used at a dilution of 1:1000.
ECM degradation assay
For ECM degradation assay, glass-bottom dishes were coated with Gelatin From Pig Skin, Oregon Green® 488 Conjugate (Invitrogen) and then treated with 0.5% glutaraldehyde as described earlier [
21‐
23]. Cells were cultured on these glass-bottom dishes in DMEM, fixed and stained with anti-cortactin antibody or Rhodamine Phalloidin (Cytoskeleton). Fluorescent images were obtained using a laser scanning confocal imaging system (OLYMPUS FV1000). Cells in which dot-like degradation of Alexa-gelatin was observed were judged as positive for invadopodia.
Migration and invasion assays
Migration assays were conducted with Biocoat without Matrigel (Corning. Life sciences), and invasion assays were performed with Biocoat with Matrigel (Corning. Life sciences) following the manufacturer’s instructions. The harvested Biocoats were then stained with crystal violet, and invaded cells were counted under a microscope. Both experiments were repeated independently three times.
Animal experiments
Female athymic mice (Beijing Charles River Laboratory Animal Center) were purchased at 4–5-weeks-of-age and maintained under a specific pathogen-free environment. All animal experiments were approved by the Institutional Animal Care and Use Committee of the Sun Yat-Sen University Cancer Center.
For the tumor xenograft experiments, the tumor cells (1 × 106 cells/tumor in 100 μl DMEM) were intravenously injected through the tail vein of mice. Distant metastases in lungs were assessed and counted after 5 weeks when mice were sacrificed. Lungs and livers were excised and embedded in paraffin for further study.
The spontaneous lymph node (LN) metastasis experiments were conducted as previously reported [
24‐
26]. Briefly, 2 × 10
5 cells in 20 μl DMEM were subcutaneously injected into the footpad of the left hind limb of each mouse to generate a primary tumor. After 4 weeks, the experiments were terminated, and the popliteal LNs of the left hind feet were isolated and preserved in RNAlater solution (Invitrogen). The primary tumor weight was measured and calculated by subtracting the weight of the contralateral foot without the tumor from the weight of the foot carrying the tumor. LNs were homogenized in TRIzol for total RNA extraction using the Bullet Blender (Next Advance). Reverse transcription and real-time PCR were performed to assess metastasis using specific primers for human HPRT, which do not cross-react with the corresponding mouse gene [
27]. The following human and mouse primers were used:
-
HPRT forward: 5′-TTCCTTGGTCAGGCAGTATAATCC-3′;
-
HPRT reverse: 5′-AGTCTGGCTTATATCCAACACTTCG-3′;
-
ACTB (universal for human and mouse) forward:
-
5′-CAATGAGCTG CGTGTGGC-3′;
-
ACTB (universal for human and mouse) reverse:
-
5′-CGTACATGGC TGGGGTGTT-3′.
Human tissue samples
To compare the mRNA expression levels of CIP4 among different stages of NPC development, 19 non-cancerous nasopharyngeal mucosa and 15 primary NPCs were obtained at the Department of Nasopharyngeal Carcinoma, Sun Yat-sen University Cancer Center (SYSUCC). In total, 169 formalin-fixed and paraffin-embedded NPC specimens were obtained from patients at SYSUCC pathologically diagnosed between February 2006 and December 2009. The 169 cases of NPC with sufficient follow-up data qualified for analyses after immuno-histochemical (IHC) staining for CIP4. All human tissue samples were obtained with patient consent and the approval of the Institutional Clinical Ethics Review Board at SYSUCC.
In IHC analysis of CIP4, the paraffin-embedded slices were deparaffinized, rehydrated, and blocked in 5% bovine serum albumin (BSA) at room temperature for 20 min. The samples were incubated with rabbit polyclonal antibody against CIP4 (ab108313, Abcam) at a dilution of 1:100 at 4 °C overnight followed by horseradish peroxidase (HRP) anti-rabbit immunoglobulin at a concentration of 1:100 for 30 min at 37 °C. The primary antibodies were detected with 3, 3-diaminobenzidine substrate visualization and counterstaining with hematoxylin (GTVision III Detection System/Mo & Rb). For each tumor, we determined a proportion score and an intensity score. Cytoplasmic and membranous staining intensity were categorized as follows: absent staining as 0, weak as 1, moderate as 2, and strong as 3. The percentage of stained cells was categorized as no staining = 0, 1–10% of stained cells = 1, 11–50% = 2, 51–80% = 3, and 81–100% = 4. The proportion and intensity were then multiplied to produce a total score ranging from 0 to 12. The median score of CIP4 (score = 4) was used as the cutoff value to divide the patients into the high (> median) and low (≤ median) CIP4 expression groups.
Statistical analysis
Student’s t-test was used to compare two independent groups of data. The median IHC staining score was used as a cut-off value to divide the patients into low and high CIP4 expression groups. Chi-squared tests were applied to analyze the relationship between CIP4 expression and clinicopathological status. The significance of several variables for survival was analyzed using the Cox regression model in a multivariate analysis. P-value < 0.05 was considered statistically significant in all cases.
Discussion
The main obstacle in the current clinical management of NPC is metastasis [
36]. Given its high metastasis rate, NPC cell motility has been linked to the formation of different types of cellular membrane protrusions. Lamellipodia extend long distances through the extracellular matrix and pull cell through the tissues. In filopodia, actin polymerization directly pushes the cytomembrane forward [
37‐
39]. Invadopodia deliver matrix-degrading metalloproteases to clear a path for cells through the extracellular matrix [
40]. Our functional studies confirmed that silencing CIP4, the regulator of invadopodia, impaired MMPs-mediated degradation of collagen to generate the ECM tracks.
CIP4 is an F-BAR protein that regulates actin-based cell motility [
30]. Roles of CIP4 in cell migration have been described in neuronal, B lymphoma cells and breast cancer [
20,
41,
42]. However, we demonstrate the role of CIP4 in the regulation of invadopodia formation, cell-migration and cell-ECM degradation during NPC metastatic events in the present study. We show that inducible silencing of CIP4 results in defects in EGFR signaling and impaired motility and invasion of NPC cells. We also tested the effects of CIP4 silencing on NPC metastasis in tumor xenograft assays and observed a key role for CIP4 in NPC metastasis. Importantly, our study also profiled CIP4 expression in human nasopharyngeal carcinoma patients, which revealed links between high CIP4 levels and worse prognosis. Together with our findings in NPC models, these studies identify CIP4 as a key signaling hub in NPC metastasis.
N-WASP and Cdc42 are critical for the formation of invadopodia, which are specialized cytoskeletal structures that combine localized actin protrusion with matrix metalloproteinases (MMPs) secretion to degrade extracellular matrices and allow invasion [
43,
44]. The formation of invadopodia requires the activation of the Cdc42–N-WASP pathway [
45]. We found that CIP4 is fully indispensable in mediating the activation of a CDC42/N-WASP, a function likely fulfilled by the other members of the family. Instead, CIP4 is essential for the formation of invadopodia.
Since the majority of NPCs express high levels of EGFR, there has been considerable interest in testing EGFR signaling. Several previous studies have functionally linked CIP4 to EGFR trafficking and downstream signaling to pathways controlling cell motility and invasiveness [
32,
46]. In the present study, we showed that silencing CIP4 in NPC cell lines resulted in impaired EGFR signaling to ERK, whereas high CIP4 expression promoted activation of the EGFR/ERK/MMP-2 axis in NPC cells. Others have also reported a role for CIP4 in promoting Src activation and Cadherin switching in mammary epithelial cells treated with EGF or TGFβ [
32].
Acknowledgments
Not applicable.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (
http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.