Synthesis and chemical optimization of FAAH inhibitors
ARN14280 ([3-(3-carbamoylphenyl)-4-(difluoromethoxy)phenyl] N-cyclohexylcarbamate) and ARN14633 ([4-fluoro-3-[3-(methylcarbamoyl) phenyl]phenyl] N-cyclohexylcarbamate) were prepared according to synthetic procedures as described in the patent application WO2015157313. Briefly, ARN14280 was synthetized in a four-step procedure, starting from commercially available 4-benzyloxy-2-bromo-phenol, through a difluoromethylation reaction (diethyl bromodifluoromethylphosphonate, KOH, CH3CN, − 10 °C to room temperature, 2 h), followed by Suzuki cross-coupling reaction (3-carbamoylbenzeneboronic acid, Pd (OAc)2, K3CO3, EGME/H2O, 50 °C, 20 min, 95% over 2 steps), a Pd/C catalyzed hydrogenative deprotection (10% Pd/C, cyclohexene, 2-MeTHF, reflux, 2 h) and a carbamoylation reaction (cyclohexyl isocyanate, Et3N, CH3CN, rt., 16 h, 71% over 2 steps). ARN14633 was synthetized in a two-step procedure starting from the commercially available 3-bromo-4-fluoro-phenol, which was converted into 3-(2-fluoro-5-hydroxy-phenyl)-N-methyl-benzamide through a Suzuki cross-coupling reaction (Pd(OAc)2, S-Phos, K3PO4, THF/H2O, 50 °C, 2 h, 88%), followed by carbamoylation (cyclohexyl isocyanate, DMAP, DCM, rt., 16 h, 72%).
The chemical optimization strategy was mainly focused on designing and synthetizing a set of new analogs, bearing a variety of structural modifications on the three main regions A, B, and C of the URB597 scaffold (Fig.
1S, supplementary material), with the aim of optimizing the pharmacokinetic profile of this class of
O-biphenyl-3-yl carbamate FAAH inhibitors. Our approach consisted of evaluating the effects of the insertion of different aliphatic
N-linked groups (left side region) and different substituents on the proximal and the distal phenyl rings (central region and right side region, respectively) of URB597, on inhibitory activity and drug-like properties (Fig.
1S, supplementary material). ARN14633 bears a fluorine atom at the
para- position on the proximal phenyl ring and a methyl group on the primary carboxamide functionality at the 3′-position of the distal phenyl ring, while ARN14280 is derived by the introduction of a di-fluoromethoxy group at the
para -position on the proximal phenyl ring of URB597. The detailed medicinal chemistry exploration will be the subject of a separate publication. ARN14633 and ARN14280 are potent FAAH inhibitors (r-FAAH IC50 = 1.4 ± 0.3 and 1.5 ± 0.3 nM, respectively) with improved kinetic solubility and oral bioavailability in rats (kinetic solubility = 28 and 44 μM; oral bioavailability F = 87% and 35%, respectively) compared to the parent URB597 (kinetic solubility = 1 μM; oral bioavailability, F = 5%).
Experimental design
NTG (Bioindustria L.I.M. Novi Ligure (AL), Italy) was prepared as previously described [
23]; animals received intraperitoneal (i.p.) injection of NTG (10 mg/Kg) or its vehicle (16% propylene glycol, 6% alcohol and saline) 4 hours before testing and/or ex vivo analysis [
2] (Table
1 and Fig.
2S, supplementary material). ARN14633 and ARN14280 were dissolved in 10% PEG200, 10% Tween 80 and saline [
24], and administered i.p. at the dose of 1 and 3 mg/kg respectively. The dose was selected based on previous studies [
25] and on the overall physicochemical and metabolic properties of the
O-biphenyl-3-yl carbamate URB597, of which they are close analogs. The structure-activity and structure-property relationship studies that lead to the identification of these compounds will be the subject of a separate publication.
URB597 (3′-carbamoyl-biphenyl-3-yl-cy-clohexylcarbamate, Cayman Chemical) was dissolved in the same vehicle and was injected i.p. at a dose of 2 mg/kg [
2,
26].
Rats were given NTG or its vehicle at baseline and, 3 hours later, were treated with ARN14633, ARN14280, URB597, or their vehicle. One hour later (i.e., 4 hours from NTG/vehicle administration), a group of rats (group A) underwent the orofacial formalin test for behavioral assessment and were sacrificed at the end of the test to evaluate gene expression in medulla, cervical spinal cord (CSC) and trigeminal ganglion (TG). The second group (group B) was instead sacrificed (4 hours from NTG/vehicle administration) without being exposed to the orofacial formalin test to measure AEA, PEA, OEA, and 2-arachidonylglycerol (2-AG) in medulla, CSC and TG (Table
1 and Fig.
2S, supplementary material).
Gene expression analysis
At the end of the behavioral test, rats were euthanized with a lethal dose of anesthetic for tissue sample collection. The medulla (bregma, − 13.30 to − 14.60 mm) was dissected out in toto, while we collected CSC (C1-C2) and TG ipsilateral to the formalin injection site. Samples were rinsed in ice-cold sterile 0.9% saline, placed in cryogenic tubes, and immediately frozen in liquid nitrogen. They were subsequently kept at − 80 °C until rt-PCR processing. mRNA levels of genes encoding for c-Fos, CGRP, substance P (SP), nNOS, Tumor Necrosis Factor alpha (TNF-alpha), Interleukin 6 (IL-6) and IL-1beta (primer sequences are reported in Table
2) were measured by rt-PCR as previously reported [
2,
27,
28]. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), whose expression remained constant in all experimental groups, was used for normalization. All samples were assayed in triplicate and gene expression levels were calculated according to 2
−∆∆Ct = 2
− (∆Ct gene − ∆Ct housekeeping gene) formula by using Ct (cycle threshold) values.
GAPDH | AACCTGCCAAGTATGATGAC | GGAGTTGCTGTTGAAGTCA |
c-fos | TACGCTCCAAGCGGAGAC | TTTCCTTCTCTTTCAGTAGATTGG |
nNOS | CCGGCTACACTTCTCCTCAC | CACGAAGCAGGGGACTACAT |
CGRP | CAGTCTCAGCTCCAAGTCATC | TTCCAAGGTTGACCTCAAAG |
SP | GCTCTTTATGGGCATGGTC | GGGTTTATTTACGCCTTCTTTC |
IL-1beta | CTTCCTTGTGCAAGTGTCTG | CAGGTCATTCTCCTCACTGTC |
IL-6 | TTCTCTCCGCAAGAGACTTC | GGTCTGTTGTGGGTGGTATC |
TNF-alpha | CCTCACACTCAGATCATCTTCTC | CGCTTGGTGGTTTGCTAC |
AEA, PEA, OEA and 2-AG levels
For the evaluation of lipid concentrations in central and peripheral areas related to trigeminal pain, rats were given ARN14633, ARN14280 or vehicle and were sacrificed by decapitation after exposure to carbon dioxide [
29]. Since several factors may influence the concentrations of endogenous substances measured in post-mortem tissue samples, medulla (bregma, −13.30 to −14.60 mm), CSC (C1-C2) and TGs were quickly dissected out in toto and snap-frozen in liquid N
2. For analyses, frozen tissue samples were homogenized and lipids were extracted using a Bligh-Dyer procedure, modified as previously described [
30]. Briefly, tissues were weighed, transferred to glass vials, and homogenized in cold methanol (2 mL) containing PEA-
d4, OEA-
d4, AEA-
d4 and 2-AG-
d8 as internal standards [
30]. Lipids were extracted with chloroform (2 mL) and washed with LC/MS-grade water (1 mL). After centrifugation for 15 min at 2850 ×
g and 4 °C, the organic phases were collected and transferred to a new set of glass vials. To increase extraction efficiency, the aqueous fractions were extracted again with chloroform (1 mL) and the centrifugation step was repeated. Both organic phases were pooled and dried under N
2. Lipids were reconstituted in chloroform (2 mL) and the organic extracts were fractionated by Silica Gel G column chromatography (60-Å 230–400 mesh; Sigma-Aldrich, Milan, Italy). PEA, OEA, AEA and 2-AG levels were eluted from the silica column with 2 mL of chloroform/methanol (9:1, v/v) and then with 2 mL of chloroform/methanol (8:2, v/v). Both eluates were recovered in the same vial. The solvent was evaporated under N
2 and lipids were reconstituted in methanol/chloroform (50 μL; 9:1, v/v) and transferred to glass vials for LC/MS analyses. PEA, OEA, AEA and 2-AG levels were measured using a Xevo TQ UPLC-MS/MS system equipped with a reversed-phase BEH C18 column (2.1 × 50 mm, 1.7 μm particle size) (Waters, Milford, USA). The mobile phase consisted of 0.1% formic acid in water as solvent A and 0.1% formic acid in acetonitrile as solvent B. A linear gradient was used: 0.0–0.5 min 20% B; 0.5–2.5 min 20 to 100% B; and 2.5–3.0 min maintained at 100% B. The column was reconditioned to 20% B for 1 min. Analysis time was 4 min and the injection volume was 5 μL.
Statistical analysis
To determine the minimal sample size needed to achieve the experiments, we considered as the primary outcome the nociceptive response in Phase II of the orofacial formalin test (face rubbing time). An a priori power analysis was conducted to obtain a statistical power of 0.80 at an alpha level of 0.05 (GPower 3.1). We hypothesized a difference in total face rubbing time between NTG-treated rats (mean 170 ± 14) and those injected with NTG + inhibitors of at least 25 s (mean 145 ± 18) and thus, we estimated a sample size of 6 rats in each experimental group with an effect size of 1.55. However, due to the intergroup variability seen in the orofacial formalin test, we used a maximum of 9 rats per group.
For nociceptive responses, gene expression and lipid levels, the statistical differences between groups were determined using the one-way ANOVA followed by post hoc Tukey’s Multiple Comparison Test; a probability level of less than 5% was regarded as significant.