Background
Nitric oxide (NO), which was found in 1987 to be a physiological constituent, and in the following years, found to be synthesized in vivo, work as a signal molecule, toxicant, and antioxidant with a broad spectrum of actions among physiological and pathological processes [
1]. NO shows pro and anti-cancer abilities depending on the cell type, conditions, NO source, concentration, and NO release rate [
2,
3]. As it appears to have a crucial role in tumor biology, controlling tumor growth, migration, invasion, and angiogenesis, modulating NO-signaling might be a promising strategy in cancer treatments [
4‐
7].
Chemical agents with stabilize NO release have been developed as NO’s limitations, such aqueous solubility and instability in the presence of various oxidants, have become better understood. One such effective NO pro-drug is JS-K(O2-(2,4-dinitrophenyl)-1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate), a new nitric oxide donor that belongs to the diazeniumdiolate family of compounds. It has been designed to release NO within a cell in a sustained and controlled manner during its reaction with glutathione-S-transferase (GST), which is often overexpressed in cancer cells [
8]. Recently, increasing evidence has suggested that JS-K regulates tumor occurrence and development of tumor, such as leukemia, prostate cancer, hepatoma, multiple myeloma, and lung cancer in vitro and in vivo [
9‐
12]. However, the underlying mechanism by which JS-K influences prostate cancer cells remains unclear.
Prostate cancer (PCa) is the most commonly diagnosed neoplasm in elderly men and the second greatest cause of cancer-related deaths in the United States [
13]. Androgen ablation therapies, such as orchiectomy, systemic administration of LHRH analog/blocker or anti-androgen, are the primary treatments for advanced PCa. Although such endocrine therapies have achieved significant clinical responses, patients with advanced PCa eventually relapse with a more aggressive PCa form, which is defined as castration-resistant PCa (CRPC). Intensive studies of CRPC pathogenesis have shown that PCa recurrence is implicated in resumption of AR-dependent transcriptional activity. Dramatically, Qi et al. have found that the ubiquitin ligase E3 Siah2playsan important role in AR action regulation in CRPC. Interestingly, Siah2 is markedly overexpressed in human CRPC and found to work as a regulator for the inactive AR chromatin complexes well as to mediate degradation, thus resulting in activation of AR-regulated genes involved in cell proliferation, cell motility, and lipid metabolism. One focus throughout their study was that Siah2-dependent removal of NCoR1-bound AR allows p300-bound AR binding to androgen receptor elements (AREs) of AR target genes [
14].
The ubiquitin-proteasome pathway works in multiple steps. First, ubiquitin is activated from its precursor by addition to the ubiquitin-activating enzyme (E1); second, the activated ubiquitin is transferred to the ubiquitin-conjugating enzyme (E2); third, E2 interacts with ubiquitin-protein ligase (E3) and transfers ubiquitin to the target protein and ubiquitin; and finally, selective tagging and degradation of specific intracellular proteins are allowed according to the type of ubiquitin modification on protein substrates [
15‐
17]. Although gene transcription and ubiquitin-mediated proteolysis are two processes that seemingly have nothing in common, a growing body of evidence has indicated that the ubiquitin-proteasome pathway is intimately involved in regulating gene transcription [
18]. Qi et al. have suggested that Siah2 is a crucial mediator for reconditioning chromatin regions that govern AR-dependent transcription through degradation of inactive AR-NCoR1 complexes on promoter regions of AREs [
14]. Meanwhile, NCoR1 is a known AR co-repressor [
19], which promotes interactions between active AR-p300complexes and AREs. As is known, this process promotes CRPC formation [
14].
Interestingly, Chen et al. [
20] have shown that the abnormal ubiquitination process is found during tumor formation. Strikingly, a research article published in
Oncogene has shown thatMdm2 is an ubiquitin ligase E3 that auto-ubiquitylates itself and also ubiquitylates p53, resulting in degradation of both proteins. Furthermore, JS-K inhibits Mdm2-mediated p53 ubiquitylation, leading to p53 accumulation in Tert-immortalized, human retinal pigment, epithelial (RPE) cells [
21]. Thus, it is possible that JS-K inhibition on PCa might have been achieved by regulating the ubiquitin-proteasome pathway. In view of the fact that JS-K regulates the stability and activity of ubiquitin ligase E3 Siah2 and that Siah2 plays such an important role in CRPC progression, the goal of this study was to investigate the probable mechanism by which JS-K inhibits Siah2-regulated AR responsive genes that contribute to CRPC.
Methods
Cell culture
Human prostate cancer cell lines LNCaP was obtained from Shanghai Institute of Biochemistry and Cell Biology (SIBCB, Shanghai, China) and C4-2 was obtained from American Type Cell Culture (ATCC, USA), all of which were AR-positive. Prostate cancer cells were routinely grown in RPMI-1640 medium GIBCO, Grand Island, NY, USA, supplemented with 10% fetal bovine serum (FBS, GIBCO), 100 U/ml penicillin, and 100 U/ml streptomycin at 37 °C under an atmosphere of 5% CO2 in humidified air.
Cell proliferation assay
Proliferation of LNCaP and C4-2 cells was evaluated by Cell Counting Kit-8 (CCK-8, Dojindo, Japan) assay according to the manufacturer’s instructions. Briefly, Cells (1 × 103/well) were plated in 96-well plates (Corning Incorporated; Corning, NY, USA) for 3 days, and treated by JS-K (5 μM) for 12, 24 and 48 h. 10μLCCK-8reagentwas added to the culture medium in each well. After incubating at 37 °C for 3 h, absorbance at 450 nm of each well was measured with a microplate reader (BioTek Instruments, Inc., USA). Each experiment was repeated three times, and the data represent the mean of all measurements.
Real time quantitative PCR (RT-PCR)
Total RNA was isolated using the total RNA kit (Omega Bio-tek, Inc., Guangzhou, China) and reversely transcribed to cDNAs with a TaqMan miRNA Reverse Transcription Kit (TaKaRa, Dalian, Liaoning, China). The mRNA levels of
Siah2,
NKX3.1,
PSA,
PMEPA1, and
SLC45A3were quantified by real-time quantitative PCR performed with SYBR Premix Ex Taq II (TaKaRa; Dalian, Liaoning, China). PCR was carried out with a two-step qRT-PCR with specific primers for
GAPDH (as internal control) at 95 °C for 30s, followed by 40 cycles of amplification at95°C for 5 s and 56 °C for 30s. All results were representative of three independent assays, and the levels of mRNAs were expressed as 2
-ΔΔCT. The designed specific primers were listed in Table
1.
Table 1
Sequences for target gene primer for RT-PCR
siah2 | F: | GCCCACAAGAGCATTACCAC | 59.80 |
R: | GTTTCTCCAGCACCAGCAT | 57.60 |
NKX3.1 | F: | GCCAAGAACCTCAAGCTCAC | 59.80 |
R: | TTCTCCAAGTCTCCCAGCTC | 59.80 |
PMEPA1 | F: | CTCCACCACACACACATCG | 59.70 |
R: | CGCCTTCCTCTCACTCCTCT | 61.90 |
SLC45A3 | F: | GAGCCGAGACGAAGCAGTT | 59.70 |
R: | GCCAAAGGTTAGCAGGTTGA | 57.80 |
PSA | F: | TCCTCACAGCTGCCCACT | 60.58 |
R: | ATATCGTAGAGCGGGTGTGG | 59.98 |
Caspase-3/7 activity assay
For Caspase-3/7 activity assays, LNCaP and C4-2cells were treated by JS-K in time-dependent manner and Caspase-Glo 3/7 assay was performed in 96-well plates. Then, an equal volume of Caspase-Glo 3/7 reagent was added into each well, and the cells were incubated for 30 min at room temperature in the dark. The luminescence was measured by a luminometer (Berthold Sirius L, Germany).
Apoptosis analysis
FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, USA) was used to access the apoptosis of PCa cells induced by JS-K according to the manufacturer protocols.
Western blotting analysis
Western blotting was conducted using standard procedures, the membrane was incubated with anti-PARP (Cell Signaling Technology, USA), anti-p53 (Santa Cruz Biotechnology, Europe), anti-Bcl-2 (Cell Signaling Technology, USA), anti-Bax (Cell Signaling Technology, USA), anti-Caspase-9 (Cell Signaling Technology, USA), anti-Caspase-3 (Cell Signaling Technology, USA), anti-AR (Santa Cruz Biotechnology, Europe), anti-Siah2 (Santa Cruz Biotechnology, Europe), anti-NCoR1 (Santa Cruz Biotechnology, Europe), anti-p300 (Santa Cruz Biotechnology, Europe), Mdm2 (Santa Cruz Biotechnology, Europe), anti-Ub (Cell Signaling Technology, USA), anti-GADPH (Abcam, Cambridge, MA, USA). And then the membrane strip were probed with a secondary antibody (1:10,000, Pure Earth Biotechology Co. Ltd.), GADPH was used as a loading control.
Co-immunoprecipitation
Cells were washed with PBS prior to cell lysis in 1 ml of IP lysis buffer [20 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM EDTA, 1% Na3VO4, 0.5 μg/mL leupeptin, 1 mM phenylmethanesulfonyl fluoride (PMSF)], and Cell lysates were cleared by centrifuging at 14,000×g for 10 min at 4 °C. After the supernatant was incubated overnight at 4 °C with suitable dilutions of the primary antibody, Protein A/G Agarose (Beyotime Institute of Biotechnology, Haimen, China) was added, and incubated for additional 4 h at 4 °C. Washed precipitated proteins were analyzed by Western blot.
Statistical analysis
Each experiment was done at least twice and at least one duplicate. The results were presented as mean ± standard deviation(SD). All statistical analyses were performed using SPSS 17.0. Differences between treatments were assessed using Fisher’s Least Significant Difference test [LSD (L)]. Significant difference was inferred for P < 0.05 and extremely significant difference P < 0.01 and P < 0.001.
Discussion
Recently, it has become known that current treatments of advanced PCa, based on androgen ablation therapies such as surgical and chemical castration, are very effective treatments initially, but almost all cases progress to CRPC eventually. Accumulating evidence has revealed that in nearly all cases resumption of AR transcription activity contributes to CRPC progression [
25]. A recently identified mechanism, in which E3 ubiquitin ligase Siah2 regulates a subset of AR bound to corepressor NCoR1, results in removal of transcriptionally-inactive AR from chromatin and allows p300-bound AR binding to AREs, the mechanism of which has become the center of attention in PCa treatment investigations [
14].
Interestingly, NO inhibition of AR-function in PCa cells was first described in vitro using the NO-donor DETA/NO. This study showed that NO inhibited AR-mediated genomic function by preventing its DNA-binding activity while not decreasing AR protein concentrations or decreasing nuclear AR translocation [
26]. JS-K, activated by GST, which is frequently overexpressed in cancer tissue, is designed to release NO [
8]. Accumulating investigations have revealed that JS-K affects apoptosis and proliferation in multiple types of cancer cells [
9,
12,
27,
28], but JS-K’s mechanism for regulating PCa cells remains unclear. Therefore, the present study focused on JS-K’s possible effective mechanism upon PCa cell apoptosis and proliferation.
In this study, JS-K was shown to induce apoptosis in the PCa cell lines LNCaP and C4-2. As p53 operates as a key regulator in the apoptotic process, JS-K was reasonably expected to induce apoptosis by modulating p53. As is known, Mdm2, an ubiquitin ligase E3, is involved in p53 ubiquitin-proteasome degradation. In addition, evidence has shown that JS-K inhibits p53 degradation mediated by Mdm2 in RPE cells [
21]. However, there have been no relevant reports that reveal JS-K’s impact on p53 ubiquitin-proteasome degradation mediated by Mdm2 in PCa cells. Therefore, here, JS-K was reasonably suspected to increase p53 concentrations by blocking the ubiquitin-proteasome pathway. Consistent with this conjecture, the present initial results revealed that JS-K increased p53 protein concentrations in PCa cell lines LNCaP and C4-2 in a time-dependent manner. Furthermore, JS-K regulation of p53 was verified as inhibiting the ubiquitin-proteasome degradation pathway in these cells by measurement of the total ubiquitin protein, and it was found to be diminished, which was consistent with the present conjecture. As increasing evidence has shown a clear association between Mdm2 and p53 [
22,
29,
30], in the present study, p53 and Mdm2 interactions were also examined. In addition, to test whether JS-K activated the p53 mediated apoptosis pathway, Bcl-2 and Bax, which are involved the intrinsic mitochondrial apoptotic pathway, were examined. It was found that JS-K diminished anti-apoptotic protein Bcl-2 while increasing pro-apoptotic protein Bax, which led to activation of initiator caspase (usually caspase-9), which in turn activated executioner caspase-3 and initiated a caspase cascade reaction that eventually destroyed the cells.
A study has revealed that JS-K inhibits PCa cell proliferation through inhibition of the AR signaling pathway; this study is the only report reporting JS-K’s impact on PCa cells [
10]. Cronauer et al. have revealed that NO inhibits AR-positive PCa cell proliferation significantly more effectively than AR-negative prostate cancer cell proliferation because NO inhibits AR DNA-binding activity [
26]. In recent years, investigations of ubiquitin ligase E3 have highlighted them to be pivotal regulators of AR transcription activity in prostate cancer [
14,
31‐
33]. For instance, ubiquitin E3 ligase RNF6 induces AR ubiquitination to increase AR transcriptional activity. In the meantime, Mdm2, SKP2, and CHIP, through ubiquitination and proteolysis, regulate AR. In recent years, Siah2 has been recognized as a regulator of AR transcriptional activity, with AR having been identified to be overexpressed in PCa cells. The results from the present study showed that JS-K inhibited the ubiquitin-proteasome degradation pathway in prostate cancer cells, resulting in reduction of total ubiquitin protein. Furthermore, Siah2 protein concentrations were examined to verify the supposition that JS-K inhibited Siah2 self-ubiquitin and accumulated protein concentrations just as JS-K affects Mdm2, as has been previously reported. In accordance with expectations, JS-K increased Siah2 concentrations, but it was found that JS-K exhibited clear proliferative inhibition of PCa cell lines LNCaP and C4-2. Thus, JS-K was suspected to diminish AR and Siah2 interactions while Siah2 was a pivotal proliferation regulator of AR. Co-IP results revealed that JS-K reduced AR and Siah2 interactions in these PCa cell lines. For further confirmation, Co-IP analyses to detect AR ubiquitination, which is regulated by Siah2, and it was found that JS-K reduced AR ubiquitination. As is known, Siah2 is a significant regulator involved in regulating ubiquitin-proteasome degradation of repressed AR-NCoR1 complexes while promoting active AR-p300 complex and AREs interactions. Therefore, AR and NCoR1 interactions were examined by Co-IP and the results showed that JS-K stabilized AR and NCoR1 interactions. These results supported the supposition that, here, JS-K might have inhibited Siah2’s ubiquitin ligase ability such that ubiquitin-proteasome degradation of AR-NCoR1 was blocked. In contrast to AR-NCoR1, AR-p300 complexes were further examined and it was found that JS-K decreased AR and p300 interactions. These results further supported the supposition that JS-K inhibited cell proliferation by regulating co-regulator and AR interactions, which subsequently targeted AREs and also then performed different functions.
Acknowledgements
We wish to thank all members of our groups and Professor Hege Chen for helpful discussions and fruitful collaboration. Our research is supported by grants from the National Natural Science Funds.