Background
Astrocytes are the most abundant cell type of the brain [
1], where one of their major functions is to support neurons. They ensure optimal conditions by maintaining local ion and pH homeostasis, regulating neurotransmitters, and clearing metabolic waste [
2]. In addition, they store glycogen and supply nutrients to neurons [
3]. Dysfunction of astrocytes could therefore have serious consequences for neuron survival. One major cause of neuronal death in the central nervous system (CNS) is excessive release of glutamate and subsequent activation of neuronal
N-methyl
d-aspartate (NMDA) receptors [
4,
5]. Astrocytes prevent this neuronal excitotoxicity by sequestration of extracellular glutamate, which is mediated mainly by two Na
+-dependent transporters: glutamate aspartate transporter (GLAST/EAAT1) and glutamate transporter-1 (GLT-1/EAAT2) [
6,
7]. Consistently, loss of astrocytic glutamate uptake and metabolism is one of the key factors responsible for neurotoxicity associated with amyotrophic lateral sclerosis (ALS) [
8,
9], Alzheimer’s disease (AD) [
10], and HIV-associated neurocognitive disorders (HAND) [
11,
12]. In order to develop therapeutic interventions against excitotoxicity associated with these CNS disorders, it is critical to identify factors that regulate astrocytic glutamate transporter expression and activity.
Inflammation of the CNS generally causes a reduction of glutamate transporter expression and consequently dampens glutamate uptake capacity of astrocytes [
13,
14]. Thus, pro-inflammatory mediators such as tumor necrosis factor (TNF)-α and interleukin (IL)-1β differentially regulate glutamate transporter expression and glutamate uptake capacity in astrocytes [
13‐
16]; however, the molecular mechanisms that link inflammatory processes and decreased astrocytic glutamate uptake are not well understood. Recent evidence suggest that oncostatin M (OSM), a pleiotropic cytokine belonging to the IL-6 family, might influence neurodegenerative processes associated with a variety of brain diseases. OSM levels have been found to be elevated in both serum and brain lesions of multiple sclerosis (MS) patients [
17,
18]. In addition, high levels of OSM are spontaneously secreted by peripheral blood mononuclear cells (PBMCs) isolated from MS, AD, and HAND patients [
17,
19,
20]. Although, the precise function of OSM in these disease conditions is unclear, there is limited evidence suggesting that OSM disrupts blood-brain barrier function [
21,
22] and mediates pro- and anti-inflammatory effects in the CNS [
23‐
25]. In addition, we have previously shown, along with others, that activation of neuronal OSM receptors protects them against glutamate- and NMDA-induced excitotoxicity [
26,
27], potentially by stimulating expression of the neuromodulatory adenosine A
1 receptors [
26]. Furthermore, a recent study showed that overexpression of OSM receptor (OSMR)-β in neurons is protective against ischemic stroke, whereas decreased neuronal OSMR-β expression results in worse stroke outcomes [
28]. In contrast, earlier studies demonstrated that OSM actually mediates HIV-associated neurotoxicity in vitro [
29]; however, the potential mechanism(s) are not yet understood.
Like neurons, astrocytes may also serve as an important target for OSM in the CNS as its receptor subunits (OSMR-β and glycoprotein 130 (gp130)) are abundantly expressed in these cells [
30,
31]. Activation of OSM receptors in astrocytes has been shown to induce reactive astrogliosis [
32,
33] and stimulate expression of different matrix metalloproteinases [
34] and pro-inflammatory factors including IL-6 [
35], prostaglandin (PG) E2, and cyclooxygenase-2 [
30]. In addition, OSM has been shown to induce expression of α1-antichymotrypsin (ACT) in astrocytes [
36]. ACT is an acute phase protein that has been associated with the formation of amyloid-β deposits found in brain tissue of AD patients [
37,
38]. Taken together, these findings suggest that OSM might directly regulate the inflammatory activity of astrocytes in the CNS.
Despite the clear role of OSM in neurocognitive disease, the involvement of OSM in the regulation of glutamate uptake in astrocytes has not yet been addressed. We hypothesized that OSM down-regulates glutamate uptake process in astrocytes and thereby promote neuronal excitotoxicity. Since OSM may play an important role in HIV-1-associated neuropathogenesis [
20,
29], we further investigated whether infection with a chimeric HIV-1 (EcoHIV/NL4-3-GFP virus (EcoHIV)) [
39,
40] induces the expression of OSM and/or its receptors (OSMR-β and gp130) in cultured microglia and astrocytes.
Methods
Chemicals and reagents
3H-d-aspartate (specific activity = 10–25 Ci/mmol) was obtained from PerkinElmer (MA, USA) and Aquasafe 500 Plus liquid scintillation cocktail from Zinsser Analytic (Frankfurt, Germany). Neurobasal media, Hank’s buffered salt solution (HBSS), phosphate-buffered saline (PBS), sodium pyruvate, l-glutamine, penicillin-streptomycin, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), glutaMAX-1, and B27 supplement were from Gibco (Breda, The Netherlands). Dulbecco’s modified Eagle medium (DMEM) media and fetal calf serum (FCS) were from PAA Laboratories (Cölbe, Germany). Trypsin was obtained from Life Technologies (Breda, The Netherlands). All other cell medium components, recombinant mouse OSM, recombinant mouse IL-6, d-aspartate, l-leucine methyl ester (LME), N-methyl-d-glucamine (NMG), and the dyes used to stain cell nuclei (Hoechst 33342 and propidium iodide) were purchased from Sigma-Aldrich (Zwijndrecht, The Netherlands). DL-threo-β-benzyloxyaspartic acid (TBOA) and MEK1/2 inhibitor U0126 were obtained from Tocris Bioscience (Bristol, UK). Janus kinase (JAK) inhibitor (AG490) and phosphatidylinositol 3-kinase (PI3K) inhibitor (LY294002) were obtained from Calbiochem (CA, USA). Reagents used in immunoblotting experiments were purchased from Bio-Rad Laboratories, except polyvinylidene fluoride (PVDF) membranes that were obtained from Millipore (Amsterdam, The Netherlands). Primary antibodies, mouse monoclonal anti-β-actin, rabbit polyclonal anti-GLT-1/EAAT2, rabbit polyclonal anti-GLAST/EAAT1 (C-terminus), and FITC-conjugated anti-GFP were obtained from Abcam (Cambridge, UK); mouse monoclonal anti-glial fibrillary acidic protein (GFAP) was obtained from Millipore; goat polyclonal anti-OSMR-β (AF662) was from R&D Systems (Minneapolis, USA); mouse monoclonal anti-MAP2 and mouse monoclonal anti-α-tubulin were obtained from Sigma-Aldrich; and primary antibodies against total and phosphorylated signal transducers and activators of transcription (STAT)3, extracellular signal-regulated kinase ½ (ERK1/2), and Akt were obtained from Cell Signaling Technology (Bioke, Leiden, The Netherlands). The fluorescent dye-conjugated secondary antibodies used for Western blot, donkey anti-mouse IR Dye 680, and donkey anti-rabbit IR Dye 800CW were obtained from LI-COR Biosciences (Cambridge, UK). The fluorescent dye-conjugated secondary antibodies used for immunocytochemistry: goat anti-rabbit CY3 was obtained from Jackson ImmunoResearch Laboratories (Uden, The Netherlands); and donkey anti-mouse Alexa Fluor 488 was obtained from Molecular Probes (Breda, The Netherlands).
Animals
All procedures carried out were in strict accordance with recommendations in the Guide for Care and Use of Laboratory Animals of the National Institutes of Health, and the regulations of the Ethical Committee for the use of experimental animals of the University of Groningen, The Netherlands (License number DEC 4623A and DEC 5913A), Institutional Animal Care and Use Committee of the University of Minnesota (Protocol no: 1203A11091 and 1404A31457), as well as with the Portuguese law on Animal Care and European Union guidelines (Directive 2010/63/EU). Wild-type C57BL/6J (1–2 days postnatal) mice were obtained from Charles River and Central laboratory animal facility of Groningen. Wild-type C57BL/6J (14–15 days embryonic) mice were obtained from Harlan (Horst, The Netherlands). Animals were housed in standard makrolon cages and maintained on a 12-h light/dark cycle. They received food and water ad libitum.
Primary astrocyte culture
Primary astrocyte cultures were established from cerebral cortices of postnatal (1–2 days) C57BL/6J mice according to a previously described procedure [
41], modified to reduce microglial contamination [
42]. Approximately 2 weeks after plating, microglial cells were mechanically separated from the astrocytic monolayer by shake-off at 150 rpm for 1 h. This procedure was repeated twice with an interval of 4 days in vitro between each shake-off, followed by an overnight shake-off at 240 rpm to remove oligodendrocyte precursor cells. Enriched astrocytes were washed with HBSS buffer (in mM: 137 NaCl, 5.3 KCl, 0.3 Na
2HPO
4, 0.4 KH
2PO
4, 4.2 NaHCO
3, 5.6
d-glucose, pH 7.4) containing 1 mM ethylenediaminetetraacetic acid (EDTA) and further detached using 0.1 % trypsin (diluted in HBSS). Cells were reseeded with fresh astrocyte culture medium (DMEM supplemented with 5 % FCS, 2 mM
l-glutamine, 1 mM sodium pyruvate, and 50 U/mL penicillin-streptomycin) in multiwell plates (5 × 10
4 cells/cm
2) and maintained in culture to confluence. To further reduce microglial contamination, confluent astrocyte cultures were treated with 5 mM LME, a lysosomotropic agent [
43], for 4–5 h. Astrocytes were ready for experiments after 1–2 days. Our cell preparations had a high percentage of astrocytes (≥95 %), which was confirmed by immunostaining against GFAP (astrocyte marker) and CD11b (microglial marker) (Additional file
1: Figure S1) [
44]. Although with low abundance, it is possible that the presence of microglial cells (approx. 5 %) in astrocyte cultures may influence some of the observations in this study. Therefore, additional experiments were carried out to verify astrocyte specificity of OSM effects in astrocyte cultures treated with liposomal clodronate (1 mg/mL for 4 h; Encapsula NanoSciences LLC, TN, USA), which resulted in complete depletion of microglial cells (Additional file
2: Figure S2A).
BV2 cell line and primary microglia culture
The murine microglial BV2 cells were maintained in DMEM media containing 10 % FCS at 37 °C in a 5 % CO2 incubator. Primary microglia cultures were established following their shake-off (150 rpm for 1 h) from mixed glial culture flasks. The cells were cultured in standard DMEM media (supplemented with 5 % FCS, 2 mM l-glutamine, 1 mM sodium pyruvate and 50 U/mL penicillin-streptomycin), diluted in 1:1 ratio with glial-conditioned media.
Primary neuronal culture
Primary cultures of cortical neurons from mouse embryo (~E
15) were done as described previously [
26]. Briefly, cortices from embryonic brains were dissected in ice-cold HBSS supplemented with 30 % glucose. Meninges were removed, and the tissues were treated with trypsin before they were gently dissociated by trituration in neuronal culture media (neurobasal medium supplemented with 2 % B27, 1 mM sodium pyruvate, 2 mM
l-glutamine and 50 U/mL penicillin-streptomycin). Cell suspension was filtered using a cell strainer (70 μm; Falcon, Franklin Lakes, NJ, USA) before centrifugation (800 rpm for 10 min). Cells were then seeded on poly-
d-lysine (10 μg/mL)-coated 96-well plates (1 × 10
5 cells/well) and maintained in neuronal culture media in a humidified atmosphere with 5 % CO
2 at 37 °C. Culture media was refreshed 24 h later to minimize culture debris. The neuronal purity as determined by MAP2 staining was around 98 % [
26]. Cultures were used after 5 days in vitro.
EcoHIV infection
In the present work, we used EcoHIV/NL4-3-EGFP (referred to as EcoHIV, for brevity), a chimeric HIV-1 expressing enhanced green fluorescent protein (EGFP) as an indicator, which was constructed on the backbone of HIV-1/NL4-3, as described previously [
39]. Infectious EcoHIV stocks were propagated in HEK293TN cells as described [
40] and titered for the p24 HIV-1 core antigen by ELISA, following the manufacturer’s instructions (ZeptoMetrix Corporation, NY, USA). Cultured astrocytes, microglia, and BV2 cells were incubated with 35,000 pg of p24 (per 1 × 10
6 cells) during the incubation time stated in the text. Viral infectivity of cells was assessed by HIV LTR (long-term repeat) gene expression and/or anti-GFP immunocytochemistry.
RNA isolation and reverse transcription polymerase chain reaction (RT-PCR)
Cultured cells were lysed in guanidinium isothiocyanate/mono-thioglycerol (GTC
+) buffer and total RNA was extracted using a phenol-chloroform/iso-amyl alcohol step, followed by DNAse 1 treatment. Purified messenger ribonucleic acid (mRNA) was then transcribed into complementary DNA (cDNA) as described previously [
45]. The quality of the cDNA was examined using primers for the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH; see Table
1). Potential contamination of mRNA samples by genomic deoxyribonucleic acid (DNA) was checked by running reactions without reverse transcriptase, using GAPDH primers for the subsequent PCR amplification.
Table 1
Primers used for reverse transcription polymerase chain reaction (RT-PCR)
GAPDH | CATCCTGCACCACCAACTGCTTAG | GCCTGCTTCACCACCTTCTTGATG |
OSMR-β | ATTCTGGACACGAAGAGGTCAAG | TTCCACTGCAAATCACAGCG |
gp130 | TGGAAGGCACTGCCTCTTTC | CTAGAGACGCGACATAGCGGT |
GLAST | CCTTCGTTCTGCTCACGGTC | TTCACCTCCCGGTAGCTCAT |
GLT-1 | GTGCAAGCCTGTTTCCAGC | GCCTTGGTGGTATTGGCCT |
Real-time polymerase chain reaction (qPCR)
The expression of OSM, OSMR-β, gp130, GLAST, GLT-1, and HIV LTR genes was analyzed by real-time PCR using an iCycler (Bio-Rad, Veenendaal, The Netherlands) and iQ SYBR Green supermix (Bio-Rad). The housekeeping gene, hypoxanthine phosphoribosyl transferase 1 (HPRT1), was used for normalization, and it showed no variations in response to the experimental treatment (see Table
2 for primer sequences). The comparative
C
t
method (amount of target amplicon
X in sample
S, normalized to a reference
R and related to a control sample
C, calculated by 2 − ((
C
t
X,
S −
C
t
R,
S) − (
C
t
X,
C −
C
t
R,
C)) was used to determine the relative expression levels of all tested genes [
46]. Linear regression analysis of the data was performed to understand the effect of OSM treatment over time on the expression of GLAST and GLT-1 mRNA.
Table 2
Primers used for real-time polymerase chain reaction (qPCR)
GAPDH | ATGGCCTTCCGTGTTCCTAC | GCCTGCTTCACCACCTTCTT |
HPRT1 | GACTTGCTCGAGATGTCA | TGTAATCCAGCAGGTCAG |
GLAST | CCTTCGTTCTGCTCACGGTC | TTCACCTCCCGGTAGCTCAT |
GLT-1 | GTGCAAGCCTGTTTCCAGC | GCCTTGGTGGTATTGGCCT |
OSM | GTGGCTGCTCAACTCTTCC | AGAGTGATTCTGTGTTCCCCGT |
OSMR-β | ATTCTGGACACGAAGAGGTCAAG | TTCCACTGCAAATCACAGCG |
gp130 | TGGAAGGCACTGCCTCTTTC | CTAGAGACGCGACATAGCGGT |
HIV LTR | GGTCTCTCTGGTTAGACCAGAT | CTGCTAGAGATTTTCCACACTG |
IL-1β | GGCAGGCAGTATCACTCATT | AAGGTGCTCATGTCCTCATC |
TNF-α | GACGTGGAACTGGCAGAAGA | GCCACAAGCAGGAATGAGAA |
COX-2 | CTCCCTGAAGCCGTACACAT | CCCAAAGATAGCATCTGGA |
iNOS | AAGGCCACATCGGATTTCAC | GATGGACCCCAAGCAATACTT |
GFAP | GTTTCATCTTGGAGCTTCTGC | GGAGGTGGAGAGGGACAAC |
IL-6 | CCGGAGAGGAGACTTCACAG | TCCACGATTTCCCAGAGAAC |
Western blotting
Western blotting of primary astrocyte and microglia cell lysates was performed as previously described [
26]. Protein calibration controls were performed to ensure that the chosen working quantities were at non-saturating conditions (Additional file
3: Figure S3B-C). Briefly, equal amounts of protein (30 μg) were loaded onto 12.5 % sodium dodecyl sulfate-polyacrylamide gels and subsequently transferred to PVDF membranes. The membranes were blocked using Odyssey blocking buffer (OBB; diluted 1:1 in PBS) for 1 h and incubated overnight at 4 °C with different combinations of primary antibodies (diluted in 1:1 OBB and PBS-T (PBS + 0.1 % Tween 20)): goat anti-OSMR-β, rabbit anti-GLAST, rabbit anti-GLT-1, mouse anti-β-actin, mouse anti-α-tubulin, mouse anti-STAT3, mouse anti-p44/42 mitogen-activated protein kinase (MAPK), mouse anti-Akt (Pan), rabbit anti-phospho STAT3 (Tyr705), rabbit anti-phospho-p44/42 MAPK (Thr202/Tyr204), and rabbit anti-phospho-Akt (Ser473). The next day, membranes were washed in PBS-T (4 × 5 min) and incubated for 1 h at room temperature (with gentle shaking in the dark) with appropriate fluorescent dye-conjugated secondary antibodies (diluted in PBS-T): donkey anti-goat IR Dye 800CW, donkey anti-mouse IR Dye 680, and donkey anti-rabbit IR Dye 800CW. Membranes were washed again in PBS-T (4 × 5 min), and fluorescent bands were detected using LI-COR’s Odyssey infrared imaging system. The densitometry analysis of protein bands was performed using ImageJ software (NIH) [
47].
OSM and IL-6 ELISA
Supernatants from cultured BV2, primary shake-off microglia, and primary astrocytes were collected following EcoHIV infections, to measure secreted OSM levels using a mouse OSM ELISA-kit (USCN Life Science Inc., TX, USA) following the manufacturer’s instructions. Secreted IL-6 levels in astrocyte culture supernatants were measured using a mouse IL-6 ELISA Ready-SET-Go kit (Affymetrix, eBioscience, CA, USA), following the manufacturer’s instructions.
Determination of astrocytic glutamate uptake: 3H-d-aspartate uptake assay
d-Aspartate was used as index of glutamate uptake in this study as it is a substrate for the high-affinity glutamate transporters with slow intracellular metabolization, thus allowing a more precise measure of glutamate transporter activity [
48‐
50]. The analysis of
3H-
d-aspartate uptake was evaluated as previously described [
41]. Briefly, cultured astrocytes were incubated with Krebs buffer (in mM: 132 NaCl, 4 KCl, 1.2 Na
2HPO
4, 1.4 MgCl
2, 6 glucose, 10 HEPES, 1 CaCl
2, pH 7.4) containing
3H-
d-aspartate (0.1 μCi/mL) and 50 μM
d-aspartate for 10 min at 37 °C. Subsequently, the medium was removed and the cultured cells were placed on ice and washed twice with cold NMG buffer (where NaCl is replaced by
N-methylglucamine, NMG) to terminate the uptake process. The cells were lysed with 0.5 M NaOH and transferred to a scintillation vial to be mixed with liquid scintillation cocktail. The radioactivity content (disintegrations per minute) was determined using liquid scintillation counting on a TRICARB® 2900TR analyzer. The remaining cell suspension was used to determine the protein content with the bicinchoninic acid (BCA) method (Pierce Technology) [
51]. The uptake rate was expressed as the uptake per minute per milligram of protein. For saturation kinetics assays, the total
d-aspartate concentrations ranged from 5 to 200 μM. The kinetic constants (i.e., maximum velocity,
V
max, and Michaelis-Menten constant,
K
M
) were determined by using nonlinear regression fit of the data with a rectangular hyperbola, using the GraphPad Prism software (version 5.02, GraphPad Software Inc, La Jolla, CA, USA).
Induction of excitotoxicity
Confluent astrocyte cultures were treated without or with OSM (10 ng/mL for 24 h) in the presence or absence of STAT3 activation inhibitor AG490 (25 μM, added 2 h before OSM). The cultures were then washed with warm HBSS and incubated with glutamate (100 μM, diluted in neuronal culture media) at 37 °C for 30 min. The supernatants from astrocytes incubated with glutamate, hereinafter referred to as glutamateinc., were collected and applied (diluted 1:1 with neuronal media) onto 5 days old embryonic cortical neuron cultures and incubated for 1 h at 37 °C. Some neuron cultures were also treated with 50 μM glutamate for 1 h (positive control for excitotoxicity). Where indicated, neurons were pre-incubated with the NMDA receptor antagonist, dizocilpine (MK 801; 30 μM) for 30 min before the glutamate or the glutamateinc. treatment. Following glutamate treatment, the neuronal medium was refreshed and cultures were incubated for the indicated period of time before they were assessed for cellular dysfunction and cytotoxicity using MTT assay and propidium iodide labeling, respectively.
Determination of neuronal viability
(1)
MTT assay: The metabolic viability of cultured embryonic cortical neurons was measured 24 h after glutamate treatment by the colorimetric MTT (3-(4,5-dimethylthiazol-2-yl-) 2,5-diphenyltetrazolium bromide) assay, as described previously [
26,
52]. MTT solution (0.5 mg/mL final concentration) was added to cultured neurons and incubated for 4 h. Following incubation, the cells were lysed and MTT-formazan solubilized in dimethyl sulfoxide (DMSO) with an orbital shaker for 15 min. The optical density of each sample was determined using an automated ELISA reader (Varioskan Flash spectral scanning multimode reader; Thermo scientific, USA) at 570 nm, with a background correction at 630 nm.
(2)
Propidium iodide labeling: Survival of cultured cortical neurons was estimated using propidium iodide (PI; DNA intercalating dye) labeling gauged by immunocytochemistry, as described previously [
26]. Briefly, neuronal cultures treated without or with glutamate (or glutamate
inc.) were incubated with PI (5 μg/mL; directly added to culture media) for 4 h and fixed in 4 % paraformaldehyde. After a few washes with PBS, cells were blocked using 5 % normal goat serum (NGS) diluted in PBS
+ (PBS containing 0.1 % Triton-X100) for 1 h at room temperature on a shaker and subsequently stained with a mouse anti-MAP2 primary antibody (1:600; diluted in PBS
+ with 1 % NGS) and incubated overnight at 4 °C on a shaker. Following primary antibody incubation, cells were washed with PBS (4 × 5 min) and incubated with the donkey anti-mouse secondary Alexa Fluor 488-conjugated antibody (1:400; diluted in PBS
+) for 1 h at room temperature in the dark on an orbital shaker. A counterstain with Hoechst 33342 (1:1000; diluted in PBS) was performed to detect cell nuclei (not shown), and fluorescent signals were analyzed by confocal imaging using a Leica SP2 AOBS system (Leica Microsystems, Heidelberg, Germany).
Statistical data analysis
The absolute data values were normalized to control in order to allow multiple comparisons. Statistical analyses were performed by one-way analysis of variance (ANOVA) followed by Bonferroni and Dunnett post hoc tests, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL, USA) and GraphPad Prism software (version 5.02, GraphPad Software Inc, La Jolla, CA, USA). In all cases, p values <0.05 were considered statistically significant.
Discussion
This is the first report to show that treatment with OSM, a member of the IL-6 cytokine family, reduces glutamate uptake in cultured cortical astrocytes and thereby promotes excitotoxic death of cortical neurons in vitro. This effect of OSM is mediated by the down-regulation of the two Na
+-dependent glutamate transporters, GLAST, and GLT-1. As shown in Fig.
1b, OSM treatment (10 ng/mL) reduces the expression of GLAST and GLT-1 mRNA in a time-dependent manner. The down-regulation of GLAST by OSM was also confirmed at the protein level; however, the low signals obtained with the GLT-1 antibody in the Western blot analysis precluded any reliable analysis of the impact of OSM on GLT-1 protein levels in cultured astrocytes (Additional file
3: Figure S3C-D). Consistent with the down-regulation of glutamate transporter expression, OSM inhibited
3H-
d-aspartate uptake by astrocytes in a concentration-dependent manner (Fig.
2b), which mostly involved the recruitment of the JAK/STAT3 pathway (Fig.
3c), rather than the PI3K or ERK1/2 pathways. This is in agreement with the previously reported ability of OSM to induce STAT3 phosphorylation in astrocytes [
65], which we now confirmed (Fig.
3a). We further showed that down-regulation of glutamate transport in astrocytes by OSM decreased survival of cultured cortical neurons. As shown in Fig.
4a, glutamate
inc. (see the “
Methods” section) from untreated astrocytes did not affect the survival of cortical neurons, suggesting that extracellular glutamate is rapidly taken up by astrocytes. However, glutamate
inc. from OSM-treated astrocytes did cause excitotoxicity in cultured cortical neurons (Fig.
4a, b). It has been previously shown that gp130-mediated STAT3 activation precedes reactive gliosis in mouse astrocytes [
33], which might lead to nitric oxide-induced inflammatory death of neurons [
66]. In our current in vitro study, conditioned media from OSM-treated astrocyte cultures did not affect neuronal survival (Fig.
4a), and OSM treatment did not induce the production of nitric oxide in astrocyte cultures (Additional file
4: Figure S4), thus excluding the possibility of indirect oxidative stress-induced neuronal damage. These observations are supported by a recent study, where the authors showed that nitric oxide synthase is not induced by OSM in primary astrocytes and microglia [
63]. Importantly, glutamate
inc. from OSM-treated astrocytes did not affect survival of neurons in the absence of neuronal NMDA receptor activity (Fig.
4a), suggesting that the increased neurotoxicity results from the decreased glutamate uptake in OSM-treated astrocytes.
The regulation of extracellular glutamate by astrocytes is determined by the density and activity of both glutamate transporters and glutamine synthetase, the enzyme that converts glutamate to glutamine [
49]. Whether or not OSM treatment regulates glutamine synthetase expression or activity has not been addressed in this study. On the other hand, we showed that OSM treatment induces the expression of GFAP, COX2, and OSMR-β, but not gp130, in cultured astrocytes (Additional file
5: Figure S5A-C). In line with our findings, OSM has been previously shown to induce pro-inflammatory factors such as GFAP and COX2, among others in astrocytes [
30,
35]. In addition, gp130-mediated STAT3 activation in striatal astrocytes has been reported to be closely associated with neuronal damage in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) model of neurodegeneration in vivo [
33]. Furthermore, OSM/gp130-mediated STAT3 activation has been shown to mediate methamphetamine-induced astrogliosis [
32]. Based on these findings, we provide direct evidence that the activation of OSM receptor, triggering STAT3 signaling in astrocytes, impacts neuronal survival. Thus, blockade of STAT3 signaling in astrocytes might be beneficial to prevent excitotoxic neuronal death in models pertinent to many brain injuries with an inflammatory profile [
33].
Astrocyte dysfunction resulting in deficient glutamate uptake and metabolism has been reported to be a major contributing factor to the excitotoxic death of neurons in different CNS disease conditions, including HAND [
11,
12]. Thus, the identification of essential factors that regulate astrocytic glutamate transporter expression and activity might be beneficial in HAND treatment. It has been reported that HIV-1 could directly inhibit glutamate transporter expression and uptake in human fetal astrocytes, without induction of pro-inflammatory mediators such as TNF-α [
64]. The authors of this study showed that the envelope protein, gp120, alone induced effects similar to these of HIV-1 [
64]. In our study, we describe a potential gp120-independent mechanism for HIV-induced down-regulation of astrocytic glutamate transport using EcoHIV, a chimeric HIV-1 that can infect mouse cells [
39,
40]. EcoHIV itself did not down-regulate GLAST expression in cultured mouse cortical astrocytes (Fig.
7c), whereas it enhanced GLT-1 mRNA expression by 2.5-fold. Interestingly, we show that EcoHIV infection induces a fivefold increase in OSMR-β mRNA and proteins in cultured astrocytes (Fig.
7d, e), whereas OSMR-β proteins in cultured microglia were undetectable by Western blot, as described previously [
63]. We also provide evidence that EcoHIV infection induces OSM mRNA expression and protein release in BV2 cells and primary microglia (Figs.
5 and
6), but not in cultured astrocytes (Fig.
7b). In addition, it is noteworthy that the secreted OSM levels in untreated microglial culture supernatants were drastically higher, when compared to that of astrocytic culture supernatants (approximately 2000 and 40 pg/mL, respectively) (Figs.
6b and
7b), suggesting that microglial cells might be a better source for OSM release in the CNS [
18,
62]. Further analysis using astrocyte-selective OSMR-β deficient animals or cell cultures would provide better insight into the role of OSM in EcoHIV-mediated neuropathogenesis and/or impaired astrocytic glutamate uptake. Several other pro-inflammatory mediators have been shown to regulate GLAST and GLT-1 expression in astrocytes, including TNF-α and IL-1β [
67]. Real-time PCR analysis of TNF-α, IL-1β, cyclooxygenase-2 (COX-2), iNOS, and IL-6 genes in primary microglia showed an induction of these genes following EcoHIV infection (Additional file
6: Figure S6), indicating the complexity of the inflammatory processes that lead to impaired astrocytic glutamate uptake associated with EcoHIV infection.
Comparison of the findings reported in the present study with previous reports suggests that OSM has a complex profile of action in the control of neurodegeneration. In fact, previous studies demonstrated anti-inflammatory as well as neuroprotective properties of OSM, both in vitro and in vivo. For example, OSM inhibits production of pro-inflammatory mediators such as TNF-α, granulocyte macrophage colony-stimulating factor (GM-CSF), and IL-8 [
24,
25] and has been shown to suppress inflammatory processes associated with the murine experimental allergic encephalomyelitis model of MS [
24]. In addition, we have previously provided evidence for a neuroprotective effect of OSM against glutamate by up-regulating neuromodulatory adenosine A
1 receptors [
26]. In another study, direct activation of neuronal OSM receptors down-regulated the NR2C subunit of NMDA receptors and thereby prevented NMDA-induced toxicity [
27]. More recently, the complex role of OSM signaling was further demonstrated by the reported neuroprotective activity of OSM against ischemic stroke, which is dependent on neuronal OSMR-β expression and activation, with decreased neuronal OSMR-β expression leading to worse stroke outcomes [
28]. Taken together these findings and our present study, it may be concluded that the target cell addressed by OSM largely determines the pro- and anti-excitotoxic effects of this cytokine in the CNS.
In the mammalian brain, astrocytes are the predominant players in regulating the glutamate diffusion and spill over from perisynaptic areas, a pre-requisite process to maintain the high signal-to-noise ratio for synaptic communication [
6,
49]. Therefore, compromised astrocytic glutamate uptake function caused by the overproduction of cytokines such as OSM, concomitant or resulting from brain injury, might synergistically exacerbate the accumulation of extracellular glutamate at excitotoxic concentrations leading to neuronal damage. In spite of their various suggested roles in astrocytic metabolism, IL-6 family members such as OSM have been scantily explored in their effects on glutamate uptake. There is evidence that CNTF, in contrast to our present findings with OSM, enhances both expression and activity of GLT-1 in astrocytes [
68] and thereby promotes survival of neurons against excitotoxicity [
69]. Several reports suggest an induction of IL-6 in astrocytes by variety of HIV proteins such as Tat, gp120, Nef, and Vpr [
70‐
73]. Consistently, we show here that infection with EcoHIV virus for 24 h induces several-fold increase in IL-6 secretion in primary astrocytes (Additional file
7: Figure S7). However, IL-6 was shown to have no effect on glutamate uptake on cultured murine astrocytes [
74,
75], although it suppressed the increased glutamate uptake induced by prostaglandin E2 (PGE2) [
74]. Our preliminary findings show that IL-6 treatment (10 ng/mL for 24 h) did not significantly reduce GLT-1 mRNA expression in cultured astrocytes (
p = 0.08,
n = 5) (Additional file
8: Figure S8). On the other hand, we observed approximately 20 % reduction of GLAST mRNA (
p = 0.04,
n = 5) in IL-6-treated astrocyte culture (Additional file
8: Figure S8). However, this effect of IL-6 is mild, compared to the effect of OSM (10 ng/mL for 24 h) on GLAST gene expression in astrocytes (Fig.
1b and Additional file
2: Figure S2B), and requires further validation at the protein level. Taken together, in this study, we have shown that OSM, through STAT3 activation, impairs the capacity of astrocytes to remove glutamate from extracellular space, which may contribute to excitotoxic neuronal damage. This indicates that a better understanding of OSM signaling mechanisms regulating glutamate transporter level and activity may have important implications for developing novel strategies to limit excitotoxic brain damage in acute and neurodegenerative pathologies.
Abbreviations
ALS, amyotrophic lateral sclerosis; ANOVA, analysis of variance; BCA, bicinchoninic acid; CNS, central nervous system; COX-2, cyclooxygenase-2; DMEM, Dulbecco’s modified Eagle medium; DMSO, dimethyl sulfoxide; DNA, deoxyribonucleic acid; EAAT, excitatory amino acid transporter; EcoHIV, EcoHIV/NL4-3-GFP virus; EDTA, ethylenediaminetetraacetic acid; ERK1/2, extracellular signal-regulated kinase ½; FCS, fetal calf serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFAP, glial fibrillary acidic protein; GLAST, glutamate aspartate transporter; GLT-1, glutamate transporter-1; GM-CSF, granulocyte macrophage colony-stimulating factor; gp130, glycoprotein 130; GTC, guanidinium isothiocyanate; HAND, HIV-associated neurocognitive disorders; HBSS, Hank’s buffered salt solution; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; HPRT1, hypoxanthine phosphoribosyltransferase 1; IL, interleukin; JAK, Janus kinases; JNK, c-jun N-terminal kinases; LME, l-leucine methyl ester; MAP-2, Microtubule associated protein 2; MAPK, mitogen-activated protein kinase; MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; mRNA, messenger ribonucleic acid; MTT, 3-(4,5-dimethylthiazol-2-yl-) 2,5-diphenyltetrazolium bromide; NGS, normal goat serum; NMDA, N-methyl-d-aspartic acid; NMG, N-methyl-d-glucamine; OBB, Odyssey blocking buffer; OSM, oncostatin M; OSMR, oncostatin M receptor; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; PGE2, prostaglandin E2; PI, propidium iodide; PI3K, phosphatidylinositol 3-kinase; PVDF, polyvinylidene fluoride; SAPK, stress-activated protein kinases; STAT, signal transducers and activators of transcription; TBOA, DL-threo-β-benzoyloxyaspartate; TNF, tumor necrosis factor
Acknowledgements
The authors wish to thank Dr. Knut Biber (Department of Psychiatry and Psychotherapy, University of Freiburg, Germany) for his valuable suggestions that significantly improved the findings of this manuscript.