Background
Photoreceptor cell death plays important role in the pathogenesis of vision impairment in several retinal degenerative disorders, for instance, retinitis pigmentosa (RP), Stargardt disease, and age-related macular degeneration (AMD) [
1,
2]. Light damage to the retina is causally associated with human retinal degeneration [
3]. Light-induced retinal degeneration in rodents is primarily characterized by apoptotic photoreceptor cell death, mimicking clinical pathologies of human retinal disorders [
4]. Thus, animal model of light-induced retinal degeneration is widely adopted to investigate retinal protective therapies against the loss of photoreceptors. To date, no effective photoreceptor protective therapies are clinically available yet, and therapeutic development targeting photoreceptor cell death is required for optimal vision preservation.
Oxidative stress is causally associated with cell death through multiple mechanisms and is regarded as one of the central players in the pathogenesis of various retinal degenerative disorders [
5‐
8]. Accumulated evidence has also supported an important role of inflammation in the pathogenesis of retinal degenerative disorders [
9‐
11]. Celastrol is a naturally occurring quinone methide triterpene present in Celastraceae family herbs that have a long history of usage in traditional Chinese medicine to treat chronic inflammation and autoimmune diseases in patients [
12]. In addition to the effects on inflammation, autoimmune disorders, cancer, and obesity [
13‐
16], the neuroprotective effect of celastrol in part implicating the mechanism of anti-oxidative stress has also been reported in a number of models [
17‐
20]. A recent study has also reported that celastrol protects ganglion cells (GC) from optic nerve crush-induced damage through inhibiting retinal expression of TNF-α [
21]. However, whether celastrol could protect photoreceptors from degeneration remains to be addressed.
In the current study, the effect of celastrol on light-induced retinal degeneration was evaluated in BALB/c mice. The results revealed significant morphological and functional protection of celastrol against bright light-induced retinal damage. The results also demonstrated that bright light caused prominent oxidative stress in retinal pigment epithelium (RPE), enhanced retinal expression of proinflammatory genes, microglial activation, and retinal gliosis and leukostasis in retinal vasculature, which were significantly inhibited by celastrol treatment.
Methods
Animals
Four- to 5-week-old female BALB/c mice were purchased from Shanghai Laboratory Animal Research Center. Mice were housed in a 12/12-h light-dark cycle room with temperature of 25 ± 2 °C. For bright light exposure experiments, mice were dark-adapted for 24 h prior to white light exposure (compact fluorescence lamp, 45 W, Chaoya Lighting, Shanghai, China) at 5000 lx for 2 h and 10,000 lx for 2 h or 30 min. All the animal handling procedures were reviewed and approved by the Institutional Animal Care and Use Committee of Shanghai University of TCM and carried out in adherence to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.
Chemicals
Celastrol was purchased from Sigma-Aldrich (USA), dissolved in DMSO, and administered to mice 30 min prior to light exposure via intraperitoneal injection (i.p). Mice unexposed to bright light and light-exposed mice without celastrol treatment received DMSO injection only. All-trans-retinal (atRAL) and lipopolysaccharides (LPS) were obtained from Sigma-Aldrich (USA).
Cell culture
ARPE19 cells were purchased from the American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco, Thermo Fisher Scientific, USA) supplemented with 10 % fetal bovine serum, 50 μg/ml streptomycin, and 50 U/ml penicillin (Gibco, Thermo Fisher Scientific, USA). RAW 264.7 cells were obtained from Shanghai Institute of Biological Science (SIBS) and grown in Dulbecco’s modified Eagle medium (DMEM) (Gibco, Thermo Fisher Scientific, USA) with 10 % fetal bovine serum, 50 μg/ml streptomycin, and 50 U/ml penicillin (Gibco, Thermo Fisher Scientific, USA).
LPS stimulation
After pretreatment with celastrol at indicated concentrations for 30 min, ARPE19 or RAW 264.7 cells were stimulated with LPS at concentrations of 1 μg/ml and 5 ng/ml, respectively. Cells were then harvested for RNA extraction 6 h after LPS treatment.
In vitro detection of reactive oxygen species (ROS)
For in vitro ROS detection, ARPE19 cells were pretreated with celastrol at indicated concentrations for 30 min prior to incubation of atRAL at 20 μM. ROS probe 2′,7′-dichlorofluorescein diacetate (DCF-DA) (Sigma-Aldrich, USA) was then added to cells at 400 nM and incubated at 37 °C for 10 min. ROS signal from various treatments was obtained at the same setting using IncuCyte ZOOM (ESSEN Bioscience, USA). Fluorescence quantification was performed with IncuCyte ZOOM software using of the setting of green fluorescence integrated intensity. Relative fluorescence intensities were calculated for statistical analyses.
Optical coherence tomography (OCT)
OCT (Optoprobe, Canada) was performed after anesthesia of mice by pelltobarbitalum natricum, i.p, at the dose of 65 mg/kg bw. Pupils were dilated by 1 % tropicamide prior to OCT imaging.
Histology and immunohistochemistry (IHC)
Eyes were enucleated, fixed in 4 % paraformaldehyde, and processed for paraffin embedding. Paraffin sections 4 μm thick were subjected to hematoxylin and eosin (H&E) staining and measurement of the thickness of outer nuclear layer (ONL). For IHC, cryosections 12 um thick were incubated with primary antibodies including mouse anti-Rhodopsin (1: 2000, Novusbio, USA), rabbit anti-opsin M (1: 100, Millipore, USA), goat anti-GFAP (1:200, Abcam, USA), rabbit anti-vimentin (1:50, Cell Signaling Technology, USA), rabbit anti-Iba1 (1:500, Wako, Japan), or rabbit anti-COX2 (1:100, Abcam, USA), which was followed by incubation of secondary antibodies including Cy3-conjugated sheep anti-mouse, sheep anti-rabbit, or rabbit anti-goat secondary antibodies (1: 1000, Sigma-Aldrich, USA). 4-6-Diamidino-2-phenylindole (DAPI) staining was performed for nuclei visualization and measurement of the thickness of outer nuclear layer (ONL). Images were observed under fluorescent microscope (DM6000B, Leica, Germany).
Electroretinogram (ERG)
Under dim red light, the dark-adapted mice were anesthetized with a mixture of ketamine hydrochloride (82.5 mg/kg bw) and xylazine (8.25 mg/kg bw). Scotopic ERGs were generated with flashes of green light at intensities ranging from −2 log cd s m−2 to 3.1 log cd s m−2. Five recordings were made at sufficient intervals between flash stimuli (from 5 s to 1 min) to allow recovery from any photobleaching effects. ERG was recorded and analyzed with the universal testing and electrophysiological system, Ganzfeld (Phoenix Research labs, USA).
Cryosections 8 μm thick were used for TUNEL staining following the manufacturer’s instructions (DeadEnd™ Fluorometric TUNEL system, Promega, USA). Images were observed under fluorescent microscope (DM6000B, Leica, Germany).
Real-time PCR analysis
Total RNA extraction of mouse retinas, ARPE 19, and RAW 264.7 cells was performed using TRIzol reagent (Invitrogen, USA). Reverse transcription was performed using PrimeScript RT Master Mix (TaKaRa, Japan) and real-time PCR was performed using QuantiTect SYBR Green PCR Master Mix (Qiagen, USA) on Roche LightCycler 480 II. All samples were run in triplicates; fold changes of the expression of genes were calculated according to 2
−[Ct(target gene)−Ct(Gapdh)]. The primer sequences were listed in the Table
1.
Mouse IL1β | TGCCACCTTTTGACAGTGATG | AAGGTCCACGGGAAAGACAC |
Mouse Ccl2 | AGCTGTAGTTTTTGTCACCAAGC | GTGCTGAAGACCTTAGGGCA |
Mouse COX2 | CCGTACACATCATTTGAAGAACTTA | CTACCATGGTCTCCCCAAAGAT |
Mouse TNFα | ACGTCGTAGCAAACCACCAA | GCAGCCTTGTCCCTTGAAGA |
Mouse ICAM-1 | TCCGGACTTTCGATCTTCCAGCTAC | CCAGGTATATCCGAGCTTCAGAGGC |
Mouse VCAM-1 | AAGAAAGGGAGACTGTCAAAGAACT | AACTTCATTATCTAACTTCCTGCCC |
Mouse VEGF | GTACTTGCAGATGTGACAAGCCA | GGTGACATGGTTAATCGGTCTTT |
Mouse GAPDH | CCGGTGCTGAGTATGTCGT | CCTTTTGGCTCCACCCTTC |
Human IL1β | TTATTACAGTGGCAATGAGGATGAC | GGAAGGAGCACTTCATCTGTTTAG |
Human Ccl2 | CTCATAGCAGCCACCTTCATTC | CTCTGCACTGAGATCTTCCTATTG |
Human COX2 | GATTTGACCAGTATAAGTGCGATTG | GTTTGGAGTGGGTTTCAGAAATAAT |
Human TNFα | CCTCTCTCTAATCAGCCCTCTG | CTACAACATGGGCTACAGGCTT |
Human ICAM-1 | AAGATAGCCAACCAATGTGCTAT | AAGATAGCCAACCAATGTGCTAT |
Human GAPDH | ACTCTGGTAAAGTGGATATTGTTGC | GGAATCATATTGGAACATGTAAACC |
In vivo detection of ROS
Dihydroethidium (DHE) (Sigma-Aldrich, USA) was administered to the mice, i.p, at a dose of 20 mg/kg bw 2 h prior to euthanization. Cryosections 12 μm thick were subject to assessment of ROS signal under fluorescent microscope (DM6000B, Leica, Germany).
Leukostasis assay
Intracardial perfusion was performed using 50 ml of 0.9 % saline solution, followed by perfusion of fluorescein-conjugated concanavalin A (ConA) (Vector Laboratories, USA) at the dose of 6.25 mg/kg bw. After ConA perfusion, unbound ConA was flushed out by perfusion with 50 ml of 0.9 % saline solution. Retinal flatmounts were examined under fluorescent microscope (DM6000B, Leica, Germany).
Statistical analysis
All results were expressed as mean ± standard error of mean (S.E.M.). Statistical analyses were performed using independent-samples T test (SPSS 18, USA). Differences were considered statistically significant if p values <0.05.
Discussion
The current study revealed that celastrol protected the retinas from morphological and functional impairment in bright light-exposed BALB/c mice. The retinal protection of celastrol was accompanied by remarkable suppression of light-induced photoreceptor apoptosis, ROS overproduction in RPE and photoreceptor cells, retinal expression of proinflammatory factors, leukostasis, retinal microglial activation, and gliosis.
Light-induced oxidative stress in the retina is causally associated with the pathogenesis of retinal degenerative disorders in patients and animal models [
4,
33,
34]. Accumulated evidence supports an essential role for oxidative stress in RPE dysfunction that is primarily implicated in the pathogenesis of AMD. Oxidative damage to RPE is an early event in the development of AMD, and RPE dysfunction contributes to the loss of photoreceptors during the progression of AMD [
35,
36]. The current study revealed rapidly occurring oxidative stress in RPE in bright light-exposed BALB/c mice. It is also noteworthy that oxidative stress in RPE was found to be more prominent and persistent than that detected in photoreceptor. The oxidative stress in RPE was readily detected 3 h after bright light exposure when only a few apoptotic photoreceptor cells were observed (Additional file
1: Figure S4 and Fig.
2). Prominent RPE oxidative stress was concomitant with increased photoreceptor cell death seen at 1 day after bright light exposure but was prior to massive photoreceptor cell death detected at 3 days after bright exposure (Additional file
1: Figure S4 and Fig.
2), providing in vivo evidence supporting that RPE oxidative stress is likely implicated in photoreceptor cell death. Most importantly, a remarkable effect of celastrol on suppressing light-induced oxidative stress in RPE was demonstrated (Fig.
3). Moreover, reduced level of ROS was observed in atRAL-stimulated ARPE 19 cells as a result of celastrol treatment, suggesting a direct effect of celastrol on attenuating oxidative stress in RPE cells (Fig.
8). These results partially explained the protective effects of celastrol against photoreceptor degeneration, and more importantly, they provided a potential pharmacological solution to alleviating oxidative stress in RPE.
Oxidative stress is noted as a principal mechanism of tissue stress, triggering inflammatory response in the retina [
37‐
39]. The crosstalk between oxidative stress and inflammation is witnessed at molecular level as well. For instance, during retinal inflammation, oxidative stress is required for CCL2 production in response to inflammatory stimuli, which plays critical roles in promoting inflammation response by recruiting and activating various immune cells including monocytes, macrophages, and lymphocytes [
40]. Celastrol treatment not only resulted in strong inhibition of light-induced oxidative stress in RPE but also significantly suppressed retinal expression of proinflammatory genes including Ccl2 in vivo. Moreover, activation of resident microglia plays important role in modulating inflammatory responses during the course of neurodegeneration. Activated microglia promotes neurodegeneration by secreting proinflammatory factors such as IL1β and TNFα [
41,
42]. In human, retinal microglial activation is noted to be an event associated with photoreceptor death in several forms of retinal degenerative disorders [
43]. Activated microglia has been increasingly recognized as hallmark pathology in degenerative retinas and contributes significantly to photoreceptor loss in mouse models manifesting light-induced retinal degeneration [
11,
44,
45]. Moreover, therapies with inhibitory effects on microglial activation have been demonstrated to be neuroprotective in light-challenged retinas, emerging as new beneficial concepts for tackling related retinal degenerative disorders. For instance, it has been revealed that minocycline suppresses microglial activity in cultured microglial cells, attenuates microglial activation in the retinas, and protects against bright light-induced retinal degeneration in vivo [
44]. Translocator protein (18 kDa) is highly expressed in reactive retinal microglia [
46,
47], and a recent study has shown that it can be successfully targeted to counteract microglial activation and bright light-induced mouse retinal degeneration [
45]. Inhibition of microglial activation is also protective against light-induced retinal damage in rats [
48]. Of interest, it has been demonstrated that celastrol is equipped with direct suppressive effect on microglia activity in vitro. For example, it has been shown that in cultured mouse microglial BV-2 cells, celastrol inhibits LPS-induced upregulation of proinflammatory factors such as IL1β and TNFα [
49]. Celastrol also suppresses double-strand RNA-stimulated microglial activation in mouse microglial MG-6 cells [
50]. Here, we further showed that celastrol treatment suppressed bright light-induced retinal microglial activation in vivo (Fig.
7a). Given the neurotoxic nature of activated microglia, we reason that a direct suppressive activity of celastrol on microglial activation could contribute significantly to its protective effects against bright light-induced retinal degeneration.
Additionally, LPS-stimulated proinflammatory gene expression was significantly suppressed by celastrol treatment in ARPE19 and RAW264.7 cells (Fig.
9). However, LPS-induced TNFα expression was not observed in ARPE19 cells as that in RAW264.7 cells (Fig.
9b). These findings suggest that although both RPE and immune cells are likely the cellular targets of the anti-inflammatory actions of celastrol, they may play differential part in promoting inflammatory response under stress conditions.
Leucocytes play a crucial role in inflammation by interacting with endothelial cells, migrating to the sites of inflammation and releasing inflammatory cytokines. Under inflammatory conditions, endothelial cells are activated and express adhesion molecules including VEGF, ICAM-1, and VCAM-1 that cause leukocyte-endothelial cell interactions [
51]. ICAM-1-mediated leukostasis has been identified as an early pathological event in the mouse model of diabetic retinopathy [
52,
53]. Significantly enhanced expression of ICAM-1, VCAM-1, and VEGF in light-exposed retinas together with leukostasis in the retinal vasculature (Fig.
6 and Additional file
1: Figure S5) were observed prior to massive photoreceptor death (Fig.
2b), providing additional evidence supporting the notion that inflammation is associated with photoreceptor degeneration. However, future studies are required to delineate the link between leukostasis and photoreceptor death. Nonetheless, celastrol was shown here to significantly suppress the expression of ICAM-1 and VCAM-1 and decrease leukostasis lesions in retinal vasculature in bright light-exposed mice. These results may reinforce the concept of anti-inflammation in developing photoreceptor protective therapies. Moreover, LPS-induced ICAM-1 expression was not observed in APRE19 cells as that seen in RAW264.7 cells (Fig.
9b), and celastrol significantly suppressed LPS-induced ICAM-1 expression in RAW264.7 cells, further suggesting differential contributions of RPE and immune cells in inflammatory responses and the anti-inflammatory activity of celastrol.
Lastly, it is also noted celastrol does not have as significant an impact on steady-state retinal gene expression in the mice without bright light exposure (Additional file
1: Figure S7) as that in the mice exposed to bright light (Figs.
3b,
4 and
6c). Among eight genes analyzed, a marginal decrease of less than 30 % in the expression of VCAM-1 was observed 6 h but not 24 h after celastrol administration. A similar marginal decrease in VEGF expression was observed 24 h after celastrol administration. An about 1.9-fold increase in Ccl2 was observed in the retinas 6 h after celastrol administration. The rest of genes exhibited no significant changes.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
YC and TZ conceived the project, analyzed the data, and wrote the paper. MB performed the experiments, analyzed the data, and wrote a part of the paper. XD, JC, PW, WW, and WZ performed the experiment and analyzed the data. All authors read and approved the final manuscript.