Methamphetamine alters microglial immune function through P2X7R signaling

Male C57BL/6 mice 6 weeks of age were purchased from Jackson Labs, housed in specific pathogen-free conditions, and given unlimited access to food and water. Protocols for the use of animals were in accordance with the guidelines of and were approved by the Institutional Animal Care and Use Committees of Temple University, which is an American Association for the Accreditation of Laboratory Animal Care accredited facility.

Methamphetamine hydrochloride was purchased from Sigma-Aldrich (St. Louis, MO). Mice were weight-matched and randomly divided into saline or METH groups. Mice in the METH group were subcutaneously administered a gradual escalating METH dose twice a day from 0.675–10 mg/kg over 6 days, with total doses for each day represented in Fig. 5a. Beginning on day 7, mice were subcutaneously administered a single dose of 10 mg/kg/day until the mice were sacrificed on day 56.

Embryonic stem cell-derived microglia (ESdM), a generous gift from Dr. Harald Neumann (University of Bonn Germany; Bonn, Germany), were cultured in DMEM/F12 50:50 (Thermo Fisher Scientific; Waltham, MA) containing N2 supplement (Invitrogen; Waltham, MA) with 0.048 mM l-glutamine (Thermo Fisher Scientific), 1 % d-glucose (Sigma-Aldrich; St. Louis, MO), and 1 % penicillin/streptomycin (Thermo Fisher Scientific). The ESdM are stable proliferating cells with most characteristics of primary microglia and are a suitable tool to study microglial function in vitro [17, 18].

Reagents were purchased from the following sources: methamphetamine hydrochloride (METH) (Sigma-Aldrich); P2X7R antibody (Alomone; Jerusalem, Israel); tyrosine hydroxylase (TH) (Abcam; Cambridge, England); and pHrodo and Calcein-AM (Life Technologies; Waltham, MA). Poly-L-lysine (PLL), lipopolysaccharide (LPS), and cytochalasin D (Cyto D) were purchased from Sigma-Aldrich. Cell viability was determined by LIVE/DEAD assay (Invitrogen) and showed that METH at 1-1000 μM concentration had no toxic effects on microglia after 48 h of exposure (Additional file 1: Figure S1). The concentration of METH (100 μM) used in the present study is similar to other published studies [19, 20]. Optimal concentrations of cytochalasin D (5 μM), fractalkine (CX3CL1) (10 ng/mL), LPS (1 μg/ml), pHrodo (40 μg/ml), and Calcein (5 μM) were determined from dose- and time-dependent response studies.

Brains of mice administered with escalating non-toxic doses of METH were harvested, fixed in 4 % paraformaldehyde, embedded in paraffin, and sectioned coronally at 5 μm. Following deparaffinization and dehydration, antigen retrieval was performed using Citrate Buffer reagent (Sigma-Aldrich). Sections were blocked with 4 % BSA and incubated with 1:100 dilution of antibodies specific for P2X7R (Alomone Labs) and Iba-1 (Wako) or 1:1000 TH (Abcam). Antibodies were detected using Alexafluor conjugates (1:500 for P2X7R and Iba-1 or 1:1500 for TH). DAPI was used for nuclear stain. The immunostained cells were observed using an Eclipse I-80 Microscope (Nikon, Melville, NY) fitted with a CoolSnap-EZ digital camera (Photometrics, Tucson, AZ). Image acquisition analysis was performed using NIS Elements R (Nikon) imaging software.

The expression of TH was quantified on ×20 images using ImageJ 1.42 software and analyzed based on integrated density, which is the intensity multiplied by the area of the particles analyzed (http://​rsbweb.​nih.​gov/​ij/​) as described [21].

The change in the gene expression profile of the purinergic receptor P2X7 in ESdM cells was analyzed using real-time quantitative PCR (qPCR). ESdM cells were seeded at a density of 2 × 10⁵ cells per well in six-well plates followed by treatment with 100 μM METH for a time-course from 4 to 72 h (Additional file 2: Figure S2). Total RNA was isolated using the Quick-RNA™ MiniPrep as per manufacturer’s instructions (Zymo Research; Irvine, CA). RNA purity and concentration was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). Conversion to complementary DNA (cDNA) was performed by reverse transcription using [1 μg of total RNA] the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Foster City, CA). Primers were designed for P2X7R forward primer 5′-GAGGTGACGGAGAATGTC-3′, P2X7 reverse primer 5′-GCGCCTGGGATACTCAG-3′, and P2X7 probe 5′-/56-FAM/ACACTGCAGACTACACCTTCCC/36-TAMSp/-3′. cDNA (diluted 1:20) along with forward and reverse primers were mixed with Taqman Master mix. qPCR was performed on an Applied Biosystems StepOnePlus Real-Time PCR System (Applied Biosystems). The PCR conditions consisted of an initial melting cycle at 95 °C for 15 min, followed by 40 cycles of amplification at 95 °C for 15 s (denaturation), 60 °C for 30 s (annealing), and 72 °C for 30 s (extension). Raw data was analyzed using the ΔΔCt method (relative quantification). Results were expressed in relative gene expression levels (fold change) compared to the untreated control.

To assess the change in protein expression of the receptor P2X7, ESdM cells (500,000 per T75 flask in 10-ml N2 medium) were incubated with 100 μM METH for 24, 48, and 72 h. IL-1β was used as a positive control. The cells were washed with PBS before protein was isolated for whole cell lysate using Cell Lytic Reagent and Protease Phosphatase Inhibitor Cocktail or protein fractionation using mammalian Protein Extraction Kit (Thermo Fisher Scientific). Cells were lysed per manufacturer’s instructions, and protein concentration was determined using the BCA assay method. Thirty micrograms of protein per lane was separated by SDS-gel electrophoresis using 10 % Tris-Glycine gels at 80 V. After gel electrophoresis, the whole cell lysate, membrane fraction, and cytoplasmic fraction proteins were transferred to nitrocellulose membranes overnight at 4 °C. Membranes with whole cell lysates and cytoplasmic fractions were blocked with 5 % milk before being immunostained overnight for rabbit anti-P2X7R (1:1000, Alomone; Jerusalem, Israel) or mouse anti-GAPDH (1:20,000, EMD Millipore MAB374; Darmstadt, Germany) as loading. Secondary HRP-linked polyclonal anti-rabbit or anti-mouse antibody (1:2000, Cell Signaling Technology; Danvers, MA) was incubated for 1 h at room temperature in 5 % milk before developing with SuperSignal West Femto Chemiluminescent Substrate (Thermo Fisher Scientific). Membranes with cell membrane fractions were first rinsed briefly in distilled water and stained with Ponceau S solution (Po-S) (0.5 [w/v] in 1 % [v/v] acetic acid) for 2 min, rinsed in distilled water to remove excess stain, and imaged using a G:Box Chemi HR16 (Syngene; Fredrick, MD) gel documentation system [22]. Protein levels were normalized to Ponceau-S used as loading control (70–100 kD) [20, 22]. Membranes were then blocked in 5 % milk for 1 h at room temperature followed by an overnight incubation with rabbit anti-P2X7R (1:1000, Alomone). Secondary HRP-linked polyclonal anti-rabbit (1:2000, Cell Signaling) was incubated for 1 h at room temperature in 5 % milk before developing with SuperSignal West Femto Chemiluminescent Substrate (Thermo Fisher Scientific). Membranes were imaged via G:Box Chemi HR16. Band intensities were measured, and normalized density values (OD) from the control were plotted.

To assess phagocytosis, ESdM cells (50,000 cells per T25 flask in 5-ml N2 medium) were incubated with pH-sensitive pHrodo-conjugated Escherichia coli bioparticles (Life Technologies). Appropriate flasks were first treated for 48 h with either METH (100 μM) alone or with 1-h pretreatment of P2X7R antagonist A 438079 (10 μM). Cytochalasin D (5 μM) treated for 1 h was used as a negative control in separate flasks. Briefly, following treatment, cells were incubated for 1.5 h with pHrodo green bioparticles (40 μg/ml) at 37 °C in 5 % CO₂. Immediately after incubation, cells were rinsed with cold phosphate buffered saline, scraped, and washed with FACS buffer (2 % BSA in PBS) before being re-suspended in 2 % paraformaldehyde and subjected to flow cytometric analysis by BD Canto II (BD Biosciences; Franklin Lake, NJ). Phagocytosis by microglia (FITC+) was quantified (to 10,000 events), and analysis was carried out using FACS DiVa software (Becton Dickinson) and FlowJo Software v 8.7 [23].

Quantitative migration assays were carried out using 8-μm pore FluoroBlock migration plates (Calbiochem; Darmstadt, Germany) as described previously [23, 24]. ESdM cells were loaded with 5-mM Calcein-AM (Life Technologies) for 45 min at 37 °C and washed prior to seeding at 50,000 cells/well in the upper chamber of the tissue culture insert. CX3CL1 (10 ng/ml) was added to the lower chamber to stimulate migration. The number of migrated cells was counted using an inverted fluorescence live cell imaging system (Carl Zeiss MicroImaging; Thornwood, NY). Each experiment was performed in triplicate, and each experimental well was imaged five times in different locations, and the results were expressed as an average of the total number of migrated cells in response to chemoattractant under each experimental condition. The images were analyzed with AxioVision version 4.7 software (Carl Zeiss MicroImaging) and with National Institutes of Health ImageJ version 1.42 software (http://​rsbweb.​nih.​gov/​ij/​) as described [25].

P2X7R expression in ESdM cells was silenced by small interfering RNA (siRNA) transfection for about 48 h. P2rx7 Trilencer-27 Mouse siRNA (OriGene Technologies; Rockville, MD) was used in conjunction with the jetPRIME transfection reagent (Polypus transfection™; Bioparc, France) to directly transfect the siRNA in N2 medium according to the transfection protocol. Briefly, ESdM cells were seeded at a density between 1-2 × 10⁵ in a T25 flask in N2 media. Five nanomolar P2X7R siRNA or scrambled siRNA was allowed to form duplexes with 8-μl jetPRIME transfection reagent in 400-μl jetPRIME buffer. Cells were transfected and incubated at 37 °C, and 5 % CO₂ for 24 h before 2 ml of N2 media was added to each flask. Cells were incubated for up to 48 h and then tested for other functional readouts. Cells in medium alone served as controls. P2X7R-specific siRNA selectively knocked down the target as assessed by qPCR using GAPDH control.

To further assess METH-induced changes in microglial function, we analyzed proinflammatory cytokine production using the Mouse ProInflammatory 7-Plex Tissue Culture Kit (MSD; Rockville MD) according to the manufacturer’s instructions. Briefly, P2X7R expression was silenced by siRNA transfection for about 48 h in ESdM cells, 1.5-2 × 10⁵ per T25 flask, as described above. Forty-eight hours after transfection, appropriate flasks were treated for 24, 48, or 72 h with METH (100 μM). Supernatants were collected, centrifuged to remove cellular debris, and concentrated using the Amicon Ultra-15 Centrifugal Filter Units (EMD Millipore; Darmstadt, Germany). Twenty-five microliters of undiluted supernatants was added to wells of the MSD plate in biological triplicates and incubated for 2 h with vigorous shaking at room temperature. Detection antibody solution was added to the wells, followed by further incubation for 1.5 h with vigorous shaking at room temperature. The plate was washed three times with PBS+ 0.05 % Tween-20, and 150 μl of 2X Read Buffer T was added to each well. Cytokine levels were estimated using provided standards and calculated by the SECTOR®Imager 2400A and MSD reader software (Meso Scale Discoveries, Rockville, MD, USA).

Data were compared statistically using the one sample unpaired t test or a one-way analysis of variance (ANOVA) followed by post hoc Student Newman Keuls test to determine which conditions were significantly different from each other, and a Tukey posttest for multiple comparisons. Results were expressed as mean values (±SE), with values deemed statistically significant when p < 0.05.

Several animal [26‐28] and human studies [15, 29] have elucidated microglial involvement in METH neurotoxicity. Building evidence supports the notion that P2X7R are regulators of neuroinflammatory processes [30] and are upregulated on microglia [31, 32] in several different pathologies. To characterize P2X7R expression in the context of METH-induced microglia activation, we analyzed the gene and protein expression of P2X7R in the ESdM [18, 23] cells after 6, 24, 48, and 72 h of METH treatment (Additional file 2: Figure S2). Changes in the messenger RNA (mRNA) expression at the 48-h time point presented the most consistent and significant fold increase (p < 0.0336) (Fig. 1a).

Our analysis of P2X7R protein from total cell lysate by western blotting showed increased expression in a time-dependent manner after METH treatment (Fig. 1b, c). Interestingly, the P2X7R protein concentration in the cytoplasmic fraction (Fig. 1b, c) was reduced in comparison to the membrane fraction after METH treatment (48–72 h). These results are consistent with previously published reports that whole cell lysates and membrane fractions of the P2X7R protein (75 kD) also show a proteolytic product of the P2X7R around 60 kD [33]. These data suggest that not only is the P2X7R protein increased at 48 h and later time points but there may also be trafficking of P2X7 from the cytosol to the membrane.

Microglial activation and subsequent migration are important to maintain CNS homeostasis in response to injury [34]. During the activation process, microglia switch from a ramified resting state to an amoeboid, motile phenotype capable of migration [34‐36]. To determine the role of P2X7R in the effects of METH on microglial migration, ESdM cells were incubated with METH for 48 h and microglial migration was evaluated in response to the chemokine attractant, CX3CL1 using transwell migration assay [23] in the absence or presence of P2X7R competitive antagonist A 438079. As represented in Fig. 2, microglia migration was significantly (p < 0.0001) increased following METH treatment. This increase was significantly attenuated with a 1-h pretreatment with A 438079 (p < 0.0001) (Fig. 2) suggesting that P2X7R plays an important role in METH-induced modulation of microglial migration.

Microglial activation is characterized by a morphological change to an amoeboid phenotype capable of phagocytosis [34‐36]. Since purinergic signaling is known to regulate microglial dynamics [37, 38] and facilitate microglial phagocytosis, we investigated the possibility that P2X7R plays a role in altered microglial phagocytic function following METH treatment. Microglial phagocytic activity was determined by quantifying fluorescence bright green E. coli bioparticle conjugates by flow cytometry [23]. The phagocytic activity represents the fold change of the percentage of the phagocytic cells in comparison with that of the control culture. Cells treated with Cyto D (5 μM), an inhibitor of cytoskeletal rearrangement, served as the experimental negative control. METH-treated microglia showed a statistically significant increase in phagocytosis (p < 0.0001) when compared to control. Pretreatment for 1 h with the P2X7R antagonist A 438079 prior to METH treatment prevented the METH-induced increase in phagocytosis compared to METH alone (p < 0.0001) (Fig. 3). These results suggest that P2X7R may play a role in modulating METH-induced microglial activation.

METH-induced microglial activation is known to promote the release of proinflammatory cytokines, such as IL-1ß and TNF-α [1, 39, 40]. To evaluate the role of METH in microglial activation, we analyzed markers of inflammation subsequent to P2X7R silencing (Fig. 4a). P2X7R gene expression was silenced for about 48 h continued with METH treatment for up to 48 h. Evaluation of proinflammatory cytokines in ESdM cells following METH treatment for 48 h showed increased production of TNF-a and IL-10 (data not shown). TNF-α expression was significantly (p < 0.0363) reduced in cells transfected with P2X7R siRNA when compared to cells transfected with scrambled siRNA (Fig. 4b). A similar trend of decreased IL-10 expression (Fig. 4b) in METH-treated ESdM cells was observed in P2X7R siRNA transfected cells when compared to cells transfected with scrambled siRNA P2X7R, suggesting that P2X7R regulates METH-induced production of these two cytokines.

Most recreational METH abusers initially use lower doses, progressively increasing to higher doses and eventually engaging in increased amount and frequency of drug intake [41‐43]. In this current study to simulate a similar pattern, we used an escalating METH dose schedule for our in vivo mouse experiments to investigate the deleterious effects of METH [41‐44]. Male C57BL/6 mice were subjected to an escalating non-toxic dose of METH up to 10 mg/kg over a 7-day period (Fig. 5a), and immunohistochemical analysis of tyrosine hydroxylase (TH) was performed to evaluate dopaminergic depletion (Fig. 5b) [42, 45, 46]. In accordance with postmortem evaluation of its expression in humans and in vivo data from rodents, there was a dramatic depletion (p < 0.0001) (Fig. 5c) in TH within the striatum of METH-treated animals in comparison to control [47‐49].

To evaluate the association between the microglial P2X7R and METH-induced neuroinflammation, immunohistochemistry was performed for markers of purinergic receptor (P2X7R) and reactive microglia (Iba-1). In the control group, only a few microglia with thin and long processes were stained positive for P2X7R. However, a robust increase in Iba-1 immunoreactivity and hypertrophic cellular morphology of microglia was observed in the METH group that was particularly pronounced in the striatum in comparison to other regions of the brain. An increase in P2X7R immunoreactivity was observed in METH-treated mice compared to the saline group (Fig. 6). P2X7R expression (green) was observed in neurons and was increased concurrent with Iba-1 expression in microglia (Fig. 6). These results are consistent with reports of increases in P2X7R in patients suffering from neurodegenerative diseases and neuropathic pain [14]. This suggests that P2X7R may play a role in modulating METH-induced microglial activation.